Mint race cdna amplification set

The 5′-RACE of NbKPILP cDNA was performed using the Mint RACE cDNA amplification set (Evrogen, Russia) according to manufacturer's instructions. The following gene-specific primers were used: “pr1;” “pr2” (Table S1).

The 5′-RACE of GUS cDNA from proNbAELP:GUS transgenic plants and PME cDNA from wild-type N. tabacum plants was performed using the Mint RACE cDNA amplification set (Evrogen, Russia) according to manufacturer's instructions. The following gene-specific primers were used: “GUS rev1”; “GUS rev2”; “PME_rev1”; “PME_rev2”; and “PME_rev3” (Table S1).

Total RNA was extracted from blood cells of S. rustica using TRI Reagent (Sigma) and reverse-transcribed with MINT cDNA synthesis kit (Evrogen) according to the manufacturer’s instructions. MINT RACE cDNA Amplification Set (Evrogen) was used for 3′ and 5’ RACE. For 3’RACE, nested degenerate oligonucleotide primers were designed using the iCODEHOP algorithm [64 (link)] on the basis of the determined amino acid sequence (Table 3; #1, 2). Primers for 5′RACE (Table 3; #3, 4) were based on the DNA sequence obtained in 3’RACE. Both 3′ and 5’PCR products were cloned in pAL2-T vector, using Quick-TA kit (Evrogen, Russia), and Sanger sequenced in Evrogen.Table 3

Oligonucleotide primers used in the study

	Primer	Sequence 5′-3′
1	Sr_P26_3’_F1	ggnaaywsntayathmng
2	Sr_P26_3’_F2	tasttayattcgttgt
3	Sr_P26_5’_R1	cattgtgccaagttcccgag
4	Sr_P26_5’_R2	ccgagcaatggttgctgttta

h = a,c,t; y = c,t; s = c,g; n = a,g,c,t; m = a,c; w = a,t. Bold letters with underscore – overlaying parts of nested primers

5′RACE analysis was performed using a Mint RACE cDNA amplification set (Evrogen, Russia) according to the manufacturer's recommendations. Gene specific primers for 5′RACE were 5′-AGGCGCCGCCGATGTGAGG-3′ and 5′- CTGCCCATGGTTGCGGTGATGGTGACTG-3′.

The rapid amplification of cDNA ends (RACE) was performed after double stranded cDNA synthesis with Mint RACE cDNA amplification set (Evrogen, Moscow, Russia). To establish the 3′ end of the patient’s GAA mRNA, three rounds of subtractive hybridization were performed using Step-Out RACE technique [16 (link)], Mint RACE primer set (Evrogen, Moscow, Russia) and three gene-specific primers. The obtained PCR product was analyzed by Sanger sequencing.

cDNAs for the 5’RACE analysis were synthesized using a Mint RACE cDNA amplification set (Evrogen, Moscow, Russia) according to the manufacturer’s recommendations. PlugOligo adapter and oligodT18 (Table S1) were used for cDNA synthesis. The first round of PCR was performed using NlucP- and PlugOligo-specific primers (Table S1) carrying additional Illumina adaptor sequences. PCR products were purified using Agencourt AMPure XP (Beckman Coulter) according to the manufacturer’s recommendations. The second round of PCR was performed using primers from NEBNext Dual Index Primers Set 1 for Illumina (NEB). PCR products were purified using AMPure XP and sequenced on a NextSeq (Illumina, San Diego, CA, USA) platform. The resulting reads were processed with cutadapt v. 1.18 [35 (link)] to remove adapter sequences and 5’ poly-G tracks produced by Mint reverse transcriptase. The read mapping to pNL2.2 ACTB-NlucP, pNL2.2 RPL32-NlucP sequences was performed with bowtie 1.1.1 [36 (link)]. The cumulative coverage by 5’ read ends was computed using bedtools v 2.27.0 [37 (link)]. The total number of reads mapped within the windows surrounding the transcription start sites was no less than 700 for ACTB and 900 for RPL32.