Hipi real time pcr sybr green master mix

Manufactured by Elpis Biotech

Sourced in United States

HiPi Real-Time PCR SYBR green master mix is a ready-to-use solution for real-time PCR amplification using SYBR green detection. It contains all the necessary components, including SYBR green dye, DNA polymerase, and buffer, for efficient and sensitive real-time PCR analysis.

Automatically generated - may contain errors

Lab products found in correlation

Riboex, by GeneAll (6 mentions) 7500 real time pcr system, by Thermo Fisher Scientific (6 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)

Spelling variants of this product

SYBR green (2 citations)

6 protocols using hipi real time pcr sybr green master mix

Neuroinflammatory Cytokine Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The levels of TNF-α, IL-1β, and IL-6 in brain were measured by RT-PCR. Total RNA was extracted using RiboEX (Geneall biotechnology, Seoul, Korea) from hippocampus tissue and cDNA was synthesized using High-Capacity cDNA Reverse Transcription kit (Thermo Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed on a 7,500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) for custom-designed primers and β-actin was used for house-keeping control using HiPi Real-Time PCR SYBR green master mix (ELPIS biotech, Daejeon, Korea). Cycling conditions consisted of an initial denaturation step of 3 min at 94°C, a denaturation step of 30 s at 94°C, an annealing step of 30 s at 60°C and an extension step of a minute at 72°C followed by 40 cycles. The values obtained for the target gene expression were normalized to β-actin and quantified relative to the expression in control samples.
Each sample was run with the following primer pairs: β-actin, Forward primer: 5’- GGCTGTATTCCCCTCCATCG-3’, Reverse primer: 5’- CCAGTTGGTAACAATGCCATGT-3’; TNF-α, Forward primer: 5’-TCTTCTCATTCCTGCTTGTGG-3’, Reverse primer: 5’- CACTTGGTGGTTTGCTACGA-3’; IL-1β, Forward primer: 5’-CCTTCCAGGATGAGGACATGA-3’, Reverse primer: 5’-TGAGTCACAGAGGATGGGCTC-3’; IL-6, Forward primer: 5’-GAGGATACCACTCCCAACAGACC-3’, Reverse primer: 5’-AAGTGCATCATCGTTGTTCATACA-3’.

Ham H.J., Yeo I.J., Jeon S.H., Lim J.H., Yoo S.S., Son D.J., Jang S.S., Lee H., Shin S.J., Han S.B., Yun J.S, & Hong J.T. (2021). Botulinum Toxin A Ameliorates Neuroinflammation in the MPTP and 6-OHDA-Induced Parkinson’s Disease Models. Biomolecules & Therapeutics, 30(1), 90-97.

+ Open protocol

+ Expand

Quantitative mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA level was measured by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted using RiboEX (Geneall biotechnology, Seoul, Korea) from hippocampus tissue and cDNA was synthesized using high-capacity cDNA reverse transcription kit (Thermo Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) for custom-designed primers and β-actin was used for house-keeping control using HiPi real-time PCR SYBR green master mix (ELPIS biotech, Daejeon, Korea). Cycling conditions consisted of an initial denaturation step of 3 min at 94 °C, a denaturation step of 30 s at 94 °C, an annealing step of 30 s at 60 °C, and an extension step of a minute at 72 °C followed by 40 cycles. The values obtained for the target gene expression were normalized to β-actin and quantified relative to the expression in control samples. Each sample was run with the following primer pairs shown in the supplementary material (Supplementary Table S1).

Ham H.J., Lee Y.S., Yun J., Son D.J., Lee H.P., Han S.B, & Hong J.T. (2020). K284-6111 alleviates memory impairment and neuroinflammation in Tg2576 mice by inhibition of Chitinase-3-like 1 regulating ERK-dependent PTX3 pathway. Journal of Neuroinflammation, 17, 350.

+ Open protocol

+ Expand

Quantitative Analysis of DVL3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

DVL3 RNA level was measured by quantitative reverse transcription polymerase chain reaction (qRT‐PCR). Total RNA was extracted using RiboEX (Geneall biotechnology, Seoul, Korea) from hippocampus tissue and cDNA was synthesized using High‐Capacity cDNA Reverse Transcription kit (Thermo Scientific). Quantitative real‐time PCR was performed on a 7500 real‐time PCR system (Applied Biosystems) for custom‐designed primers and β‐actin was used for house‐keeping control using HiPi Real‐Time PCR SYBR green master mix (ELPIS biotech). Cycling conditions consisted of initial denaturation step of 3 min at 94°C, a denaturation step of 30 s at 94°C, an annealing step of 30 s at 60°C, and extension step of a minute at 72°C followed by 40 cycles. The values obtained for the target gene expression were normalized to β‐actin and quantified relative to the expression in control samples.
Each sample was run with the following primer pairs:

β‐actin, Forward primer: 5′‐ GGCTGTATTCCCCTCCATCG‐3′, Reverse primer: 5′‐ CCAGTTGGTAACAATGCCATGT‐3′;

DVL3, Forward primer: 5′‐ GTCACCTTGGCGGACTTTAAG‐3′, Reverse primer: 5′‐ CCAAAATCGTCGTCCATAGACTT‐3′;

Along with qRT‐PCR, enzyme‐linked immune‐sorbent assay (ELISA) was used to measure DVL3 RNA level. Lysates of brain tissue were obtained through a protein extraction buffer containing protease inhibitor.

Yoo S.S., Lee D.W., Ham H.J., Yeo I.J., Chang J.Y., Yun J., Son D.J., Han S, & Hong J.T. (2023). Presenilin‐2 knock‐In mice show severe depressive behavior via DVL3 downregulation. CNS Neuroscience & Therapeutics, 30(2), e14370.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RiboEX (Geneall biotechnology, Seoul, South Korea) from hippocampus tissue and BV-2 cells, and cDNA was synthesized using High-Capacity cDNA Reverse Transcription kit (Thermo Scientific, Waltham, MA, United States). Quantitative real-time PCR was performed on a 7,500 real-time PCR system (Applied Biosystems, Foster City, CA, United States) for custom-designed primers and β-actin was used for house-keeping control using HiPi Real-Time PCR SYBR green master mix (ELPIS biotech, Daejeon, South Korea). Cycling conditions consisted of an initial denaturation step of 3 min at 94°C, a denaturation step of 30 s at 94°C, an annealing step of 30 s at 60°C, and an extension step of 1 min at 72°C followed by 40 cycles. The values obtained for the target gene expression were normalized to β-actin and quantified relative to the expression in control samples. Each sample was run with a primer pair of the same sequence as shown in Supplementary Table 1.

Ham H.J., Lee Y.S., Lee H.P., Ham Y.W., Yun J., Han S.B, & Hong J.T. (2022). G721-0282 Exerts Anxiolytic-Like Effects on Chronic Unpredictable Mild Stress in Mice Through Inhibition of Chitinase-3-Like 1-Mediated Neuroinflammation. Frontiers in Cellular Neuroscience, 16, 793835.

+ Open protocol

+ Expand

Quantifying mRNA Levels in Hippocampus

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA level was assessed by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA from hippocampus tissue was extracted using RiboEX (Geneall Biotechnology, Seoul, Republic of Korea). cDNA was synthesized using a High-Capacity cDNA Reverse Transcription kit (Thermo Scientific, Waltham, MA, USA). qRT-PCR was performed on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) using HiPi Real-Time PCR SYBR green master mix (ELPIS biotech, Daejeon, Republic of Korea) with custom-designed primers. As a housekeeping control, β-actin was used. A total of 40 cycles were performed, consisting of an initial denaturation step of 3 min at 94 °C, a denaturation step of 30 s at 94 °C, an annealing step of 30 s at 56 °C, and an extension step of 1 min at 72 °C. The mRNA levels of target genes were normalized to β-actin. The primer pairs we used are shown in the Supplementary Material (Supplementary Table S1).

Ham H.J., Lee Y.S., Koo J.K., Yun J., Son D.J., Han S.B, & Hong J.T. (2024). Inhibition of Amyloid-β (Aβ)-Induced Cognitive Impairment and Neuroinflammation in CHI3L1 Knockout Mice through Downregulation of ERK-PTX3 Pathway. International Journal of Molecular Sciences, 25(10), 5550.

+ Open protocol

+ Expand

Hippocampal mRNA Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA level was measured by quantitative real-time polymerase chain reaction(qRT-PCR). Total RNA was extracted using RiboEX (Geneall biotechnology, Seoul, Korea) from hippocampus tissue and cDNA was synthesized using High-Capacity cDNA Reverse Transcription kit (Thermo Scienti c, Waltham, MA, USA). Quantitative real-time PCR was performed on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) for custom-designed primers and β-actin was used for house-keeping control using HiPi Real-Time PCR SYBR green master mix (ELPIS biotech, Daejeon, Korea). Cycling conditions consisted of a initial denaturation step of 3 min at 94 °C, a denaturation step of 30 s at 94 °C, an annealing step of 30 s at 60 °C and an extension step of a minute at 72 °C followed by 40 cycles. The values obtained for the target gene expression were normalized to β-actin and quanti ed relative to the expression in control samples. Each sample was run with the following primer pairs shown in the supplementary material (Supplementary table S1).

Ham H.J., Lee Y.S., Yun J., Son D.J., Lee H.P., Han S., & Hong J.T. (2020). K284-6111 Alleviates Memory Impairment and Neuroinflammation in Tg2576 Mice by Inhibition of Chitinase-3-like 1 Regulating ERK Dependent PTX3 Pathway.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!