Genejet

Bacterial DNA was isolated from milk using a Power Soil DNA isolation kit (Qiagen, United Kingdom) as previously described by Tong et al. (2019) (link). DNA concentration and 260/280 ratio were measured with a NanoDrop 1,000 spectrophotometer (Nanodrop Technologies, United States), and integrity was visualized by running DNA aliquots on an agarose gel. The V1-V2 region of the 16S rRNA gene was PCR-amplified with a GeneAmp 9,700 (ABI, United States) using forward (5’-CGTATCGCCT-CCCTCGCGCCATCAG-3′) and reverse (5’-CTA-TGCGCCTTGCCAGCCCGCTCAG-3′) primers that incorporated adaptors and barcodes (Tong et al., 2019 (link)). Amplicons of about 450 bp were selected and combined in equal concentrations (Li Y. et al., 2018 (link)), then electrophoresed and extracted from the gel with GeneJET (Thermo-Fisher, Waltham, MA, United States). Paired-end libraries were prepared by Majorbio Bio-Pharm (Shanghai, China). Bacterial rRNA genes were sequenced with Illumina HiSeq (Illumina, United States) to obtain paired-end reads of 300 base pairs. All raw sequence data were uploaded to NCBI (#SRP254162).

Culturable bacteria were isolated by using plate coating. Bacteria were isolated on Luria-Bertani (LB) media or nutrient agar (NA). Afterward, 10 g of leaves were placed in conical flasks with 300 ml of sterilized water and shaken for 1 h at 200 rpm, then 30, 40, and 50 ml supernatants were spread on both LB and NA plates. Once the plates underwent dark conditions for 2–5 days at 28°C, colonies with the same morphology, color, and growth rates were isolated. Axenic cultures were stored in 40% glycerin with LB bacterial solution at −20°C (LB: 40% glycerin = 1:1). The bacterial DNA was extracted using TIANamp Bacteria DNA Kit (Tiangen Biotech Co. Ltd., Beijing, China) according to the operating steps. The amplification of the 16S rRNA gene of isolates was carried out based on the procedures described by Li et al. (2021 (link)). Resultant PCR products were electrophoresed on a 1% agarose gel and the execution of targeted fragment size (16S 1600 bp) purification was done using Gene JET (Thermo Fisher Scientific, Waltham, MA, United States), then sequenced and used as a query in a BLASTN search of the NCBI nr database1. Moreover, for the identification of the isolates, matches with identity values >98% were used.

All plasmids were maintained in Escherichia coli and purified with a standard plasmid miniprep kit (GeneJet, Thermo Scientific). Plasmid controls were pBR322 (4,361 bp; New England Biolabs), pUC19_yEGFP3 (3,397 bp), pUG72 (3,988 bp; originally pJJH726, EUROSCARF), pSH63 (6,998 bp), and YGPM3k20_pGP564_chrV (26305 bp; Open Biosystems).

All the plasmids used in this study are listed in Additional file 1: Table S1, which were constructed by the Gibson Assembly method [26 (link)], using linear fragments purified from PCR products. The promoter and terminator sequences from Additional file 1: Table S2 were amplified by PCR using Synechocystis 6803 genomic DNA as template. The RBS sequences were selected as 22-bp immediately preceding the translational start codon of each gene. The DNA fragments for construction of the plasmids pCA-UC118 and pCB-SC101 were amplified from Synechocystis 6803 genomic DNA, plasmid pUC118 [34 (link)], and plasmid pSC101 [35 (link)], respectively. All of the plasmids for assay of promoter, RBS, and terminator activities were ligated to the plasmid backbone pRSF1010, which is a derivative of the pPMQAK1 broad host range vector [6 (link)].
All PCR amplifications were performed using Phusion High-fidelity DNA polymerase (Thermo Scientific). Plasmids and PCR products were purified using the GeneJET (Thermo Scientific) plasmid miniprep kit and gel extraction kit, respectively. Oligonucleotides were designed using the SnapGene software (GSL Biotech LLC) and synthesized by IDT (Coralville, IA). All oligonucleotides used in this study are listed in Additional file 1: Table S3.

The amplicons were purified using silica gel purification columns (GeneJET, Thermo scientific), sequenced using Sanger’s dideoxy chain termination method and the sequences aligned using Sequencher Version 5.0 (SciGenom Labs Pvt Ltd, Cochin). Bidirectional sequencing was done with both forward and reverse primers. The sequences were aligned using EMBOSS (www.bioinformatics.nl>cgi-bin>merger) and blasted using NCBI BLAST tool (www.blast.ncbi.nlm.nih.gov>blast) to analyze their similarity with other published sequences available in online databases. Sequences corresponding to partial 18S rRNA gene of B. gibsoni were downloaded from online databases and aligned with the corresponding partial sequence of B. gibsoni obtained in this study and were further utilized for the construction of phylogenetic tree using maximum likelihood method. The bootstrap consensus tree was inferred from 1000 replicates, in Dambe 5.5.24.

The Cas9 plant expression vector (pHSE401) was digested with BSaI and the DNA fragment containing Cas9 was eluted using a GeneJET (Thermo Fisher Scientific) kit. Ligation of sgRNA in digested pHSE401 was carried out at 22 °C for 4 h using T4 DNA ligase (New England BioLabs), according to Khan et al. [22 ]. After four hours of ligation, the ligation product was transformed into chemically competent cells of E. coli DH5α and colony PCR was performed with specific primers (U6-26-F and dT4-R) to confirm sgRNA ligation:

U6-26-F: 5’TGTCCCAGGATTAGAATGATTAGGC3’

dT4-R: 5’AAACGTAATATTAAACGGATGGCC3’

From the PCR-confirmed clones, plasmid DNA was isolated with a GeneJET Plasmid Miniprep (Thermo Fisher Scientific) kit and, before transformation into Agrobacterium (GV3101), the clones were confirmed through sequencing.

One mL of cyanobacterium culture was collected, and the biomass was separated by centrifugation at 10000 ×g for 15 min. DNA was extracted using a genomic DNA extraction kit (GeneJET, Thermofisher). A segment of 16S rRNA gene regions were amplified by PCR using the 16S-27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 16S-1492R (5’-GGTTACCTTACGACTT-3’) primers (12 (link)).
The amplification process was 34 cycles of amplification starting with 3 min at 94°C, then followed by repeated cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C, using Taq DNA polymerase. The termination cycle was 10 min at 72°C. The PCR products were analyzed on 1.5% (w/v) agarose gel using tris-borate-EDTA (TBE) buffer. The PCR product was also sequenced. The national center for biotechnology information (NCBI) nucleotide BLAST tool was used to find homologous and other close sequences.