Promoter plasmids were custom designed by Seqwright Inc USA. The miR-145, miR-329 and PPARγ promoter sequences were retrieved from the UCSC Genome Browser and the rat (rn4) genome assembly was used for sequence comparison, alignment, and primer design. The promoter sequences were amplified from the rat gDNA using specific primers and cloned into the mammalian promoter-less pGL3-Basic expression vector (Promega USA) to generate wildtype plasmids. Cloning primers used for the miR-145 were 5’-ATA TCT CGA GGG AGA GAG ATG CCT TCA GCA-3’ and 5’-ATT TAT AAG CTT GGA ATC CTT CTC AAC ACT GAA TAT CTA C-3’ and for miR-329 were 5’-ATA TCT CGA GGC CAG TGT CCC GGT CTC CCT ACT GC-3’ and 5’-ATA AAT AAG CTT CTG ACA AGA CTA CCT CGG AAC TTC CCC AAC GTG-3’. The sequence and orientation of the promoters was confirmed by restriction enzyme digestion and automated DNA sequencing. To generate mutant plasmids, site-directed mutagenesis was performed to generate point mutations in all four PPREs on the miR-145 and miR-329 promoters, and in the miR-145 and miR-329 target sites in the PPARγ promoter. Four base pairs were mutated on each PPRE to increase the robustness of the mutants. The mutations were confirmed by automated DNA sequencing.
Pgl3 basic expression vector
Manufactured by Promega
Sourced in United States
The PGL3-Basic expression vector is a plasmid designed for high-level expression of recombinant proteins in eukaryotic cells. It contains a strong promoter, a multiple cloning site, and a selectable marker for stable transfection. The core function of this vector is to serve as a reliable tool for the expression and purification of target proteins.
Automatically generated - may contain errors
Lab products found in correlation
Glomax 20 20 luminometer, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Luciferase assay kit, by Promega (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Let 7e 5p mimic, by RiboBio (1 mentions)
Glomax multi detection system, by Promega (1 mentions)
Prl tk renilla luciferase plasmid, by Promega (1 mentions)
Victor2 luminometer, by PerkinElmer (1 mentions)
Passive lysis buffer (plb), by Promega (1 mentions)
Rapamycin, by Merck Group (1 mentions)
9 protocols using pgl3 basic expression vector
1
Cloning and Mutagenesis of Promoter Plasmids
2
Cloning LRRK2 Gene Promoter Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LRRK2 gene promoter fragments were amplified from genomic DNA of human embryonic kidney (HEK) 293 cells by PCR and then cloned into pGL3-Basic expression vector (Promega) upstream of the luciferase reporter gene by restriction enzymes. Ten promoter deletion plasmids for 5’ flanking region of human LRRK2 gene were generated to cover from −1738 bp upstream to +133 bp downstream of TSS at guanine (+1). The primers, including restriction enzyme sites, were synthesized as follows: forward, 1) - 1738NheI: ctagctagcgaaacaacttagaaaataatacactg, 2) -794NheI: ctagctagccccaagtatcaggatcctgcc, 3) -495 BglII: cttagatctggagataggcggc, 4) -413Nhe: ctagctagcggtcgcggagggtggccggc, 5) -118XhoI: ccgctcgagtcgtttttgggcctgagt, and 6) -34XhoI: ccgctcgagtccttcctcataaacaggcg; reverse, 1) -794HindIII: cccaagcttggcaggatcctgatacttggg, 2) -413HindIII: cccaagcttgccggccaccctccgcgacc, 3) -34HindIII: cccaagcttaggcagctccccgccccgcgt, 4) -4HindIII: cccaagcttgcgcccacgcccgcctgttta, and 5) +133HindIII: cccaagctttggcacctgcttccaacccgccg.
3
Promoter Construction for ESRP1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate promoter constructs, human ESRP1 (gene ID: 54845) promoter sequence was retrieved from the Eukaryotic Promoter Database (https://epd.vital-it.ch/ ). The ESRP1 gene promoter from −1748 bp upstream to +110 bp downstream of the TSS at +1 was amplified by PCR and inserted in the pGL3-Basic expression vector (Promega) using genomic DNA as a template, and the deletion construct ESRP1-1482 was derived from pGL3-1748. Primers were as follows: ESRP1-1748 Fw (5′- GGGGTACCCTGGCCTTCGCCCGCTCTCA-3′), ESRP1-1482 Fw (5′-GGGGTACCGGCTGGACACCTAGAGCCGA-3′) and Rev (5′-CGGCTAGCAGGCGGTAAGGTGGTGTGGA-3′). ESRP1 deletion construct was cloned between the KpnI F and NheI R sites.
4
HDAC6 Regulation of IL-13 Promoter Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (1X105) were seeded in 6-well plate. After 24 h, 2 µg of HDAC6 plasmid was transfected with TurboFect in vivo Transfection Reagent following the manufacturer’s protocol. For the luciferase assay, an IL-13 promoter sequence fragment (CTGGGAGTCAGAG) was synthesized and cloned into the pGL3-Basic expression vector (Promega). Luciferase activities were measured with a Dual-Luciferase Reporter Assay system and a GloMax 20/20 luminometer (Promega). In addition, luciferase assay data are presented as the mean ± SD of three independent replicates. P < 0.05 was considered to indicate a significant difference in all statistical analyses.
5
Generating ESRP1 Promoter Constructs
6
Regulation of Pgc1α by let-7e-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids carrying the Renilla luciferase gene linked to a fragment of the Pgc1α 3′-UTR harbouring let-7e-5p putative-sites were co-transfected into 3T3-L1 cells along with either control miRNA or let-7e-5p mimic (RiboBio, China). A mutant 3′-UTR of Pgc1α was constructed by site-directed mutagenesis of let-7e-5p from AUGGAG into GUAACG. 3T3-L1 cells were cultured in DMEM (Gibco, USA) containing 10% CS and seeded in 12-well plates. At 24 h after plating, 0.2 mg of firefly luciferase reporter plasmid, 0.2 mg of pGL3-basic expression vector (Promega, USA) and equal amounts (20 pmol) of let-7e-5p mimic or scrambled negative control RNA were transfected into cells with Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. A pGL3-basic vector was used as a transfection control. At 24 h post transfection, the cells were analysed using a luciferase assay kit (Promega, USA). All experiments were performed in triplicate wells for each condition and repeated three times independently.
7
Characterizing PFKFB3 Hypoxia Response Elements
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
103, 89 and 75 bp fragments spanning PFKFB3 HRE1, HRE2 and HRE3 were individually amplified using MCF7 genomic DNA as a template and cloned between KpnI and XhoI sites of the pGL3 basic expression vector (Promega, E1751). The primers used to amplify the fragments are enlisted in Supplementary Table S2 . Cells were seeded in a 24-well plate and allowed to attach. The wells were co-transfected with different PFKFB3-HRE luciferase constructs along with pRL-TK renilla luciferase plasmid (Promega, E2231). 12 h post-transfection, the cells were subjected to appropriate treatments for 12 h. Subsequently, the cells were lysed, and the luciferase activity was determined using GloMax- Multi Detection System (Promega) by normalizing to the Renilla luciferase activities.
8
Cloning and Characterization of SRSF2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SRSF2 gene was cloned using the pCMV-3Tag-1a overexpression plasmid from Agilent (240195) and MCF7 cDNA. The amplification was carried out using Phusion DNA polymerase, and the SRSF2 overexpression fragment was inserted between the EcoRI forward and BamHI reverse sites. To investigate the role of transcription factors in regulating SRSF2 expression, a deletion construct of the SRSF2 promoter was created by retrieving the promoter sequence from −2000bp to +100bp of the transcription start site from the Eukaryotic Promoter Database (https://epd.vital-it.ch/ ) and amplified using PCR and Phusion DNA polymerase. The amplified fragment was cloned into the pGL3-Basic expression vector (Promega, E1751) between the Kpn1 forward and XhoI reverse sites.
To clone the SRSF2 3′UTR containing miR-222-3p binding sites (wild type and mutant), approximately 100 bp long 3′UTR forward and reverse strands were commercially synthesized. The oligonucleotides were annealed by incubation for 4 minutes at 95°C. The microtube was allowed to cool gradually at room temperature, and the resulting duplex oligonucleotide was cloned in a pMIR reporter plasmid. All plasmids were verified by Sanger sequencing. The primers used for the cloning are listed inTable S3 .
To clone the SRSF2 3′UTR containing miR-222-3p binding sites (wild type and mutant), approximately 100 bp long 3′UTR forward and reverse strands were commercially synthesized. The oligonucleotides were annealed by incubation for 4 minutes at 95°C. The microtube was allowed to cool gradually at room temperature, and the resulting duplex oligonucleotide was cloned in a pMIR reporter plasmid. All plasmids were verified by Sanger sequencing. The primers used for the cloning are listed in
9
DHPR-α1.1 Promoter Regulation in C2C12 Myoblasts
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!