Taqman snp

Genomic DNA was extracted in a QIAcube instrument following the manufacturer’s standard protocol for saliva nucleic acid extraction (QIAGEN, Valencia, CA). After isolation, allelic discrimination for the ADA gene was determined via real-time polymerase chain reaction (PCR) using a TaqMan SNP genotyping assay using fluorogenic probes (Applied Biosystems, CA). Thermal cycling was performed on StepOne Real-Time PCR system (Applied Biosystems, CA). The amplification mix contained the following ingredients: 12.5 μL of PCR master mix (QIAGEN, Valencia, CA), 1.25 μL of TaqMan 20X working stock, 10.25 μL of RNase- and DNase-free water (Sigma), and 1.0 μL of sample DNA, in a total volume of 25 μL per single tube reaction. The PCR conditions were 95 °C for 10 minutes followed by 40 repeated cycles of 95 °C for 15 seconds and 60 °C for 60 seconds. Genotypes were determined automatically via the StepOne software (Applied Biosystems, CA) based on the fluorescence signals. Samples were run in duplicate and in the case of a call discrepancy, samples were rerun.

Genomic DNA was extracted in a QIAcube instrument following the manufacturer's standard protocol for saliva nucleic acid extraction (QIAGEN, Valencia, CA, USA). After isolation, allelic discrimination for the COMT gene was determined via real‐time polymerase chain reaction (PCR) using a TaqMan SNP genotyping assay using fluorogenic probes (Applied Biosystems, CA, USA). Thermal cycling was performed on StepOne Real‐Time PCR system (Applied Biosystems). The amplification mix contained the following ingredients: 12.5 μl of PCR master mix (QIAGEN), 1.25 μl of TaqMan 20× working stock, 10.25 μl of RNase‐ and DNase‐free water (Sigma), and 1.0 μl of sample DNA, in a total volume of 25 μl per single‐tube reaction. The PCR conditions were 95°C for 10 min followed by 50 repeated cycles of 92°C for 15 s and 60°C for 90 s. Genotypes were determined automatically via the StepOne software (Applied Biosystems) based on the fluorescence signals. Samples were run in duplicate and in the case of a call discrepancy, samples were rerun.

The real-time polymerase chain reaction allelic discrimination technique was used to investigate the rs2285666 of ACE-2 and the rs12252 of IFITM-3 polymorphisms using the TaqMan SNP genotyping assay kit (Thermo Fisher Scientific, Waltham, MA, United States) with catalog no. C___2551626_1 and C_175677529_10, respectively, and their context sequences were as follows: (VIC/FAM) ATAATCACTACTAAAAATTAGTAGC (C/T) TACCTGGTTCAAGTAATAAGCATTC and (VIC/FAM) GCATCTCATAGTTGGGGGGCCTGG (A/G) CTGTTGACAGGAGAGAAGAAGGTT, respectively, as shown in Figures 1 and 2. The PCR mixture contained 7.5 μl of TaqMan genotyping master mix (Applied Biosystems), 0.75 μl of TaqMan SNP (probes), 1 μl of genomic DNA (1–10 ng), and 5.75 μl nuclease-free water. Thermal conditions were as follows: initial denaturation at 95°C for 10 min and 40 cycles were run at 95°C for 15 s (denaturing), followed by 60°C for 1 min (annealing/extension).