The full-length human p53 (residues 1–393) and human p53 (residues 2–393) were cloned into the pET25 vector (MilliporeSigma, Burlington, MA, USA) and the pGEX-4T-3 vector (GE Healthcare Life Sciences, Chicago, IL, USA) respectively. Recombinant GST-tagged p53 proteins and N-terminal His6-tag-p53 proteins were purified using protocols from the manufacturer and purified proteins were dialyzed against Assay Buffer (10 mM Hepes/KOH, pH 7.4, 5 mM KH2PO4, 5 mM Succinate, and 250 mM Sucrose) at 4°C. In vitro BAK oligomerization assays were performed as described previously (11 (link),18 (link)). Briefly, 25 μg of purified mitochondria were incubated with 100 pmol of recombinant p53 proteins. After 30 min incubation at 4°C, the BAK oligomers were crosslinked with freshly-made 2.8 mM bismaleimidohexane (BMH) (Thermo Fisher Scientific) for 30 min at 30°C, prior to the addition of SDS loading buffer. Oligomerization products were size fractionated on 4–20% Tris-Glycine gradient gels (Lonza, Walkersville, MD, USA) and subjected to Western blotting using the BAK specific antibody anti-BAK-NT (Millipore Sigma). For all other Western blot analysis, 50–100 μg of whole-cell lysate was resolved over SDS PAGE gels using pre-cast 10% NuPAGE Bis-Tris gels (Thermo Fisher Scientific) and transferred onto PVDF membranes (IPVH00010, pore size: 0.45 μm) (Millipore Sigma) prior to analysis.
Pgex 4t 3 vector
Manufactured by GE Healthcare
Sourced in United States, Sweden
The PGEX-4T-3 vector is a plasmid designed for the expression of recombinant proteins in Escherichia coli. It contains a tac promoter for high-level protein expression, a GST tag for affinity purification, and a multiple cloning site for inserting the gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
Q5 site directed mutagenesis kit, by New England Biolabs (3 mentions)
Biacore 3000, by GE Healthcare (3 mentions)
Bl21 de3 cells, by Thermo Fisher Scientific (2 mentions)
Pegfp c1 vector, by Takara Bio (2 mentions)
B per gst fusion protein spin purification kit, by Thermo Fisher Scientific (2 mentions)
Glutathione sepharose 4b, by GE Healthcare (2 mentions)
Tris glycine gradient gels, by Lonza (1 mentions)
Pvdf membranes ipvh00010, by Merck Group (1 mentions)
Nupage bis tris gel, by Thermo Fisher Scientific (1 mentions)
Anti bak nt, by Merck Group (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pcdna5 frt to vector, by Thermo Fisher Scientific (1 mentions)
Superdex 200 column, by GE Healthcare (1 mentions)
Thrombin, by Merck Group (1 mentions)
Lb media, by BD (1 mentions)
Gst column, by GE Healthcare (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Thermo Fisher Scientific (1 mentions)
E coli bl21 de3, by Transgene (1 mentions)
High five cells, by Thermo Fisher Scientific (1 mentions)
Glutathione sepharose affinity chromatography, by GE Healthcare (1 mentions)
33 protocols using pgex 4t 3 vector
1
Purification and Oligomerization Assay for p53
2
Generating Anti-PARG Polyclonal Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cDNA fragment of the PARG gene encoding amino acids 109-408 was amplified using Platinum™ Taq DNA polymerase (Invitrogen) and the primers, BamHI PARG and NotI PARG. This fragment was ligated into a pGex-4T-3 vector (GE Healthcare) to produce the pGex-4T-3-PARG plasmid. The GST-PARG fusion protein was expressed in E.coli BL21 cells using 1 mM IPTG whilst shaking at 37°C for 2 hr. GST-PARG was purified using glutathione sepharose beads (Expedeon) and was used for sheep immunization (Orygen Antibodies Ltd). Polyclonal sheep anti-PARG antibodies were purified from generated serum by affinity purification according to standard procedures. In brief, serum was first passed through covalently coupled GST-glutathione sepharose beads to remove anti-GST antibodies. Covalently coupled GST-PARG beads were incubated with the serum, bound anti-PARG antibodies were eluted with 100 mM glycine (at pH 2.8), neutralized using 1 M sodium phosphate (pH 8.0), and dialyzed against PBS. Purified antibodies were finally run through GST-coupled sepharose beads to remove any remaining anti-GST antibodies.
3
Expression and Purification of SSRP1 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human SSRP1 cDNA corresponding to clone NM_003146 was cloned into the pcDNA5 FRT/TO vector (Invitrogen™), modified with an N-terminal Flag-TAG (gift from Zuzana Horejesi, Clare Hall Laboratories). DNA encoding full length Flag-SSRP1 1-709aa, Flag-SSRP1NTD 1-180aa, Flag-SSRP1∆HMG 1-508aa, and Flag-SSRP1∆NTD 529-709aa were amplified by PCR using primers listed below. The Flag-SSRP1R213D and Flag-SSRP1∆HMG were generated by site-directed mutagenesis with the QuikChange strategy (Stratagene) according to the manufacturer’s protocol. The DNA fragments obtained were inserted into the pGEX-4T-3 vector (GE, 28-9545-52). This vector encodes an Glutathion-S-Transferase (GST)-tag followed by a Thrombin protease cleavage site.
Primers to clone hSSRP1 cDNA into pcDNA5FRT/TO modified with N-terminal Flag-TAG
hSSRP1-attB1-Fwd
5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAGAGACACTGGAGTTCAACGACG-3′
hSSRP1-attB2-Rev
5′GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACTACTCATCGGATCCTGACGCTGAGTCC3′
Primers to clone hSSRP1 and its mutated versions into pGEX-4T-3 vector
hSSRP1-Full length-Fwd
5′-TTTTCCCGGGACCGGTTTATGGACTACAAGGACGACGATG- 3′
hPmeI-Full length-Rev
5′-TTTTGCGGCCGCGTTTAAACACCACTTTGTACAAGAAAGCTGGG- 3′
NTD-Rev
5′-TTTTGCGGCCGCGTTTAAACGGCCTCAACAGGGTCCACAC- 3′
ΔNTD-Fwd
5′-TTTTGACTCCATGGTTTGCCCAGAATGTGTTGTCAAAGGC- 3′
Primers to clone hSSRP1 cDNA into pcDNA5FRT/TO modified with N-terminal Flag-TAG
hSSRP1-attB1-Fwd
5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAGAGACACTGGAGTTCAACGACG-3′
hSSRP1-attB2-Rev
5′GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACTACTCATCGGATCCTGACGCTGAGTCC3′
Primers to clone hSSRP1 and its mutated versions into pGEX-4T-3 vector
hSSRP1-Full length-Fwd
5′-TTTTCCCGGGACCGGTTTATGGACTACAAGGACGACGATG- 3′
hPmeI-Full length-Rev
5′-TTTTGCGGCCGCGTTTAAACACCACTTTGTACAAGAAAGCTGGG- 3′
NTD-Rev
5′-TTTTGCGGCCGCGTTTAAACGGCCTCAACAGGGTCCACAC- 3′
ΔNTD-Fwd
5′-TTTTGACTCCATGGTTTGCCCAGAATGTGTTGTCAAAGGC- 3′
4
Recombinant BoNT/A HCR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The downloaded HCR domain of BoNT/A (residues T876 to L1296) was synthesized (CosmoGentech, Seoul, South Korea) with codon optimization for E.coli expression. The HCR template was amplified and subcloned into BamHI and NotI restriction sites of a pGEX4T3 vector (GE Healthcare Life Sciences, Chicago, IL) and tagged with N-terminal glutathione S-transferase. HCR/A mutants were created via overlap PCR mutagenesis. BA15 was transformed into BL21 DE3 cells (Invitrogen, Carlsbad, CA) for protein expression.
Transformed cells were grown in LB media (BD Biosciences, San Jose, CA) containing ampicillin. Expression was induced by adding isopropyl β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM with a cell density of 0.4–0.5 OD600 in an overnight culture at 18°C. Cell pellets were resuspended in ice-cold 20 mMTris pH 8.0, 200 mMNaCl lysis buffer and then disrupted via sonication (Qsonica, Newtown, CT). Supernatants were loaded onto a GST column (GE Healthcare Life Sciences). BA15 was eluted and cleaved to remove the purification tag via thrombin (Sigma-Aldrich, St. Louis, MO). The final purification was loaded onto a Superdex 200 column (GE Healthcare Life Sciences, Chicago, IL).
Transformed cells were grown in LB media (BD Biosciences, San Jose, CA) containing ampicillin. Expression was induced by adding isopropyl β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM with a cell density of 0.4–0.5 OD600 in an overnight culture at 18°C. Cell pellets were resuspended in ice-cold 20 mMTris pH 8.0, 200 mMNaCl lysis buffer and then disrupted via sonication (Qsonica, Newtown, CT). Supernatants were loaded onto a GST column (GE Healthcare Life Sciences). BA15 was eluted and cleaved to remove the purification tag via thrombin (Sigma-Aldrich, St. Louis, MO). The final purification was loaded onto a Superdex 200 column (GE Healthcare Life Sciences, Chicago, IL).
5
Recombinant Expression of Mutant pPAF-AH Proteins
6
Synthetic DNA encoding PfMCM2 protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthetic DNA encoding for the PfMCM2 1–159 protein fragment from P. falciparum (clone3D7A) carring BamI 5′end and EcoRI 3′ end restrinction sites was provided by Eurofins MWG Operon (Ebersberg, Germany). The cDNA was inserted into pGEX-4T3 vector (GE Healthcare) to generate N-terminal glutathione S-transferase (GST) fusions. GST-MCM2 mutants were obtained by site-directed mutagenesis by overlap extension PCR using the following primers: for S13A mutant: Forward: 5′-GAAGATCTGGAAGCCAACAAATATGATATTG-3′ , Reverse: 5′-CAATATCATATTTGTTGGCTTCCAGATCTTC-3′ ; for Y16A mutant: Forward: 5′-CTGGAAAAGCAACAAATTC GATATTGATGAAGAAGATCTGCTGG-3′ , Reverse: 5′-CCAGCAGATCTTCTTCATCAATATCGAA TTTGTTGCTTTCCAG-3′ ; for S13A-Y16F double mutant: Forward: 5′-GAAGATCTGGAAGCC AACAAATTCGATATTG-3′ , Reverse: 5′-CAATATCGAATTTGTTGGC TTCCAGATCTTC-3′ . A pGEX-4T3 vector containing P. falciparum CK2 in frame with an N-terminal GST tag was kindly provided by Prof. Christian Doerig. The pGEX4T3 constructs were expressed in Escherichia coli BL21 cells for 20 h at 20°C with 0.1 mM isopropyl-D-thiogalactopyranoside (IPTG). GST-tagged proteins were purified on glutathione-agarose beads, following the manufacturer's recommendations.
7
Cloning and Purification of OsWRKY70, OsMKK4, OsMPK3, and OsMPK6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length ORF of OsWRKY70 was PCR-amplified and cloned into the pET-32a vector (Novagen, Madison, WI). The full-length ORF of OsMKK4 was PCR-amplified and cloned into the pET-28b vector (Novagen), and the two phosphorylation sites (T and S) of OsMKK4 were mutant to D (OsMKK4DD) by Q5 Site-Directed Mutagenesis Kit (NEB). The full-length ORFs of OsMPK3 and OsMPK6 were PCR-amplified and cloned into the pGEX-4T-3 vector (GE Healthcare). All of primers used for PCR amplification for these genes are listed in Supplementary file 1A . The constructs were transformed into E. coli BL21 (DE3) (Transgene, China). Expression was induced by adding 0.4 (for OsWRKY70 and OsMKK4DD) or 0.2 (for OsMPK3 or 6) mM isopropyl-β-thiogalactopyranoside (IPTG) for 20 hr at 20°C (for OsWRKY70 and OsMKK4DD) or for 4 hr at 23°C (for OsMPK3 and 6). Cells were collected and the recombinant protein was purified using His or GST Trap (GE healthcare, UK) according to the manufacturer's instructions.
8
Cloning and Expression of PKD Domains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For GST-fused PKD expression, the pGEX-4T-3 vector (GE Healthcare Bio-Sciences, Pittsburgh, PA) was used to clone various AAVR PKD-encoding regions, which are diagrammed in Fig. 3A and 6A and B , into BamHI/XhoI sites.
For the expression of polyhistidine (His)-tagged PKD1, PKD2, and PKD3, the PET30a(+) vector (Novagen/EMD Millipore, Billerica, MA) was used to clone PKD1-, PKD2-, and PKD3-encoding sequences through the NdeI/XhoI sites. The coding regions of PKD1, PKD2, and PKD3 are diagrammed inFig. 3A .
For the expression of polyhistidine (His)-tagged PKD1, PKD2, and PKD3, the PET30a(+) vector (Novagen/EMD Millipore, Billerica, MA) was used to clone PKD1-, PKD2-, and PKD3-encoding sequences through the NdeI/XhoI sites. The coding regions of PKD1, PKD2, and PKD3 are diagrammed in
9
Production and Purification of Integrin I Domains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant I domains of the human integrins α1 and α2 were produced as described previously (Nykvist et al. 2000 (link)). Briefly, the α1-I domain cDNA was generated by PCR using a human integrin α1 cDNA (Briesewitz et al. 1993 (link)) as a template, cloned into the pGEX-4T-3 vector with a GST tag (GE Healthcare, USA), and the protein was expressed in E. coli. The α2-I domain cDNA was produced by PCR using a human integrin α2 cDNA (Takada and Hemler 1989 (link)) as a template, cloned into the pGEX-2T vector (GE Healthcare, USA) and the GST- α2I fusion protein was expressed in E. coli. The α11-I domain cDNA was generated similarly by PCR using a human integrin α11 cDNA (Velling et al. 1999 (link)) as a template, and then cloned into the pAcSecG2T vector (Invitrogen, USA). The α11-I domain was expressed as a GST-tagged fusion protein and secreted into cell culture media in insect High-Five cells (Invitrogen) using a Baculovirus expression system (Invitrogen). All recombinant GST-I domains were purified using glutathione-Sepharose affinity chromatography (GE Healthcare) and their purities were analyzed by SDS-PAGE.
10
Recombinant Protein Labeling and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents are required:
BL21(DE3)pLys Escherichia coli bacteria (Agilent Technologies, cat. no. 230134), pGEX-4T3 vector (GE Life Sciences, cat. no. 28-9545-52), isopropyl ß-d -1-thiogalactopyranoside (IPTG; Sigma Aldrich, cat. no. I5502), phosphate buffered saline (PBS; Sigma Aldrich, cat. no. P4417), Tween® 20 (Sigma Aldrich, cat. no. P9416), phenylmethylsulfonyl fluoride (PMSF; Fluka-Sigma Aldrich, cat. no. 78830), benzamidine hydrochloride hydrate (Fluka-Sigma Aldrich, cat. no. 12073), glutathione-agarose (Sigma Aldrich, cat. no. G4510), human thrombin (Sigma Aldrich, cat. no. T6759), Bradford protein assay (Bio-Rad, cat. no. 500-0006), tris-(2-carboxyethyl)phosphine hydrochloride (TCEP; Thermo Scientific, cat. no. 20490), dimethyl sulfoxide (DMSO; Sigma Aldrich, cat. no. 41648), AlexaFluor555C2 maleimide (Life Technologies, cat. no. A-20346), AlexaFluor647 antibody labelling kit (Life Technologies, cat. no. A-20186), recombinant human BDNF (50 ng/μl in distilled water; Peprotech, cat. no. 450-02), isoflurane (National Veterinary Services, UK), 70% ethanol solution (v/v in distilled water), saline (0.9% NaCl w/v).
BL21(DE3)pLys Escherichia coli bacteria (Agilent Technologies, cat. no. 230134), pGEX-4T3 vector (GE Life Sciences, cat. no. 28-9545-52), isopropyl ß-
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!