Abi 7300 real time system

Total RNAs were extracted from CRC tissues and cells using the TRIzol reagent (Invitrogen) according to the manufacturers’ instructions. The quality of RNAs was tested via NanoDro 2000 c (Thermo Scientific, USA). Subsequently, 3 μg RNAs were utilized as templates to produce cDNA using PrimeScript RT Reagent (Takara, Dalian, China). The SOCS3 mRNA and miR-92a were detected by a SYBR Premix Taq (Takara). The PCR processes were completed on an ABI 7300 Real-Time system (Ambion, USA) with parameters of 95°C for 40 s, 40 cycles of 95°C for 25 s, 58°C for 40 s, and 72°C for 55 s. Primers are shown in Table 1.
Table 1.

The sequences of primers for Realtime PCR

GENE	Primers
	Forward (5ʹ-3ʹ)	Reverse (5ʹ-3ʹ)
GAPDH	TGTTCGTCATGGGTGTGAAC	ATGGCATGGACTGTGGTCAT
MiR-92a	ACACTCCAGCTGGGTATTGCACTTGTCCCGG	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGCCG
SOCS3	CTCTGACTCTACACTCGCC	TAGTCCCGAAGCGAAATCTC
CD133	AGTCGGAAACTGGCAGATAGC	GGTAGTGTTGTACTGGGCCAAT
Sox2	GCCGAGTGGAAACTTTTGTCG	GGCAGCGTGTACTTATCCTTCT
OCT4	GGGAGATTGATAACTGGTGTGTT	GTGTATATCCCAGGGTGATCCTC
All R	CTCAACTGGTGTCGTGGA
U6	CTCGCTTCG GCAGCACA	AACGCTTCACGAATTTGCGT

Total RNA was extracted according to the manufacturer’s instructions of the RNAprep Pure Plant Kit (Tiangen). First-strand cDNA was synthesised using a PrimeScriptTM RT Reagent Kit (TaKaRa). Gene-specific primers of PeWRKYs and ABA-related genes were designed using Primer Express 3.0 (Table S4). Moso bamboo TIP41 (Genbank: gil242384689) or Arabidopsis Tublin was used as internal controls for normalization of the template cDNA. Real-time quantitative RT-PCR (qRT-PCR) was performed on an ABI 7300 Real-Time system (Applied Biosystems). Each reaction was performed in 20 μl (total volume) and consisted of 10 μl SYBR Green Master mix (Applied Biosystems, USA), 1 pmol of each primer, 2 μl cDNA templates and sterile H₂O. The steps performed during real-time PCR were as follows: step (1) 50 °C, 2 min; step (2) 95 °C, 7 min; step (3) (95 °C, 5 s; 60 °C, 30 s) × 40 cycles. The data from real-time PCR amplification was estimated in terms of comparative fold expression following 2^−∆∆ct method and three biological replicates were carried out.

Total RNA was isolated from cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and 3 μg RNA was used to synthesize cDNA using Superscript II reverse transcriptase (Invitrogen). Real‐time PCR was performed using a KAPA SYBR FAST qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) and ABI7300 real‐time system (Applied Biosystems, Walmington, MA, USA). Thermocycling conditions were as follows: an initial activation step at 95°C for 3 min., followed by 40 cycles of denaturation at 95°C for 3 sec. and amplification at 60°C for 33 sec. The primer sequences used are listed in Table 1. All reactions were run in triplicate, and gene expression levels were determined as fold changes using the cycle threshold comparison method. The housekeeping gene HPRT was used for normalization.

The total RNA from young leaf was extracted using TRIzol reagent (Invitrogen, Ca, USA) according to the manufacturer’s instructions. The total RNA was extracted from frozen samples using an RNAprep Pure Plant Kit (Tiangen) according to the manufacturer’s instructions. The first-strand cDNA was then synthesized using a PrimeScriptTM RT Reagent Kit (TaKaRa). Gene-specific primers were designed using Primer Express 3.0 and Tonoplast intrinsic protein 41 gene (TIP41) was used as the reference gene57 . Real-time PCR was performed on an ABI 7300 Real-Time system (Applied Biosystems). Each reaction was carried out in a final volume of 20 ul containing 12.5 μl of SYBR Green Master Mix reagent (Applied Biosystems), 1.5 μl of cDNA sample, and 1μl gene-specific primers. Each primer pair of PeIQD genes was listed in Table S6. The qPCR reaction conditions were as follows: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s, and annealing at 55–60 °C for 30 s. A melting curve was generated to analyze the specificity of the reactions, and three biological replicates were made for each biological replicate. The relative expression level was calculated as 2^−ΔΔCT [ΔC_T = C_T, _Target − C_T, _CYP2. ΔΔCT = ΔC_T, _treatment − ΔC_T, _CK (0 h)].The relative expression level [2^{−ΔΔCT, CK (0 h)}] in the control plants (without treatment) was normalized to 1 as described previously58 .

Total RNA was isolated from frozen berry skin samples per the protocol described by Boss et al. (1996) (link). DNA was removed from samples using RNase-free RQI treatment per the manufacturer’s instructions (Promega, Madison, WI, USA) followed by a cleanup with the RNeasy mini kit (Qiagen, Valencia, CA, USA). cDNA was synthesized from total RNA using the qScript™ cDNA Synthesis kit (Quanta Biosciences, MD, USA). Quantitative real-time expression was performed using PerfeCTa SYBR Green SuperMix ROX (Quanta Biosciences, MD, USA) on the ABI7300 real-time system (Applied Biosystems, CA, USA) and using UDP-glucose: flavonoid-3-O-glucosyltransferase (UFGT) gene’s primer designed with the Primer Express 2.0 software (Applied Biosystems) as described in (Afifi et al., 2021 (link)). Relative quantification for UFGT gene was calculated by the 2–ΔΔT method (Livak and Schmittgen, 2001 (link)) using the grape ubiquitin gene as a constitutive control (Fujita et al., 2005 ). The ubiquitin primer was designed from a tentative consensus sequence TC38636 and described in (Afifi et al., 2021 (link)). QRT-PCR analyses were performed using three biological replicates using sets of cDNA from independent samples. Gene expression was calculated as an increase/decrease fold change in reference to the sample collected from the untreated treatment.