Total RNA was extracted from fresh cells using TriPure Isolation Reagent (Roche). cDNA was reverse transcribed from 2 μg of total RNA by using 25 U of Supercript Reverse Transcriptase (ReverTra Ace) and 0.25 μg of Oligo(dt) 12–18 primer (Life Technology) in a 20-μl reaction mixture containing buffer, 1 mM dNTP mix, 10 mM DTT and 40 U of RNase inhibitor. The total RNA and Oligo(dt) 12–18 primer were incubated at 70°C for 10 min before RT. After incubation for 1.5 h at 46°C, the RT reaction was terminated by denaturing the reverse transcriptase for 5 min at 100°C. Regarding PCR amplification, 1.2 μl of cDNA was added to 10.8 μl of a reaction mix containging 0.2 μM of each primer, 0.2 μM of dNTP mix, 0.6 U of Taq polymerase and reaction buffer. PCR was performed in a DNA Thermal Cycler (MJ Research, PTC-220). The following primers were used: XBP-1; upstream, 5′-CAG CAC TCA GAC TAC GTG CA-3′, and downstream, 5′-CAG AGG TGC ACG TAG TCT GA-3′. GAPDH; upstream, 5′-AAA CCC ATC ACC ATC TTC CAG-3′, and downstream 5′-AGG GGC CAT CCA CAG TCT TCT-3′ was used as an internal control. The PCR products (10 μl) were resolved by electrophoresis in an 8% polyacrylamide gel in TBE buffer. The gel was stained with ethidium bromide and photographed under ultraviolet light.
Dna thermal cycler
Manufactured by Bio-Rad
Sourced in United States
The DNA thermal cycler is a laboratory instrument used for the amplification of DNA samples. It precisely controls the temperature and timing of thermal cycling to facilitate the process of DNA replication, which is essential for techniques such as polymerase chain reaction (PCR).
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Hstag premix, by GeneAll (3 mentions)
Hybrid r kit, by GeneAll (3 mentions)
Sybr green, by Takara Bio (2 mentions)
Superscript first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Pepgold bacterial dna kit, by Roche (2 mentions)
Tripure isolation reagent, by Roche (1 mentions)
Oligo dt 12 18 primer, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Taq polymerase, by Thermo Fisher Scientific (1 mentions)
Ptc 100, by Bio-Rad (1 mentions)
Total rna extraction kit, by Qiagen (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Cdna reverse transcription kit, by Qiagen (1 mentions)
Tripure reagent, by Roche (1 mentions)
Gel documentation unit, by Bio-Rad (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Taq polymerase, by Bio-Rad (1 mentions)
33 protocols using dna thermal cycler
1
RT-PCR for XBP-1 and GAPDH Expression
2
RT-PCR Analysis of TRPV6 and β-Actin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized with MMLV reverse transcriptase (Promega, Madison, WI, USA). The cDNA was amplified with Taq polymerase (Finnzymes, Espoo, Finland) in a DNA thermal cycler (MJ Research, Watertown, MA, USA). The following cycling conditions were applied: 30 cycles of 1 minute at 95℃, 45 seconds at the annealing temperature, and 1 minute at 72℃. The annealing temperatures were 57℃ for TRPV6 and 60℃ for β-actin. The primers for TRPV6 were 5′-CAAGTTCTGCAGATGGTTCC-3′ (forward) and 5′-GCAAAGGTTTTGTTGGGCTG-3′ (reverse). For β-actin, the primers were 5′-GGACTTCGAGCAAGAGATGG-3′ (forward) and 5′-AGCACTGTGTTGGCGTACAG-3′ (reverse).
3
Genotyping ApoE ε4 Allele from Whole Blood
4
APOE Gene Amplification from Blood
5
Analysis of Immune Cell Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured human monocytes and macrophages using the total RNA extraction kit (Qiagen). Total RNA concentration was determined by NanoDrop ND‐1000 spectrophotometer (NanoDrop Technologies, Inc), and purity was checked by the A260/A280 ratio (ratios between 1.8 and 2.1 were considered acceptable), in addition, an agarose gel was run to assess quality. cDNA was synthesized from 1 μg RNA with cDNA reverse transcription kit (Qiagen) The resulting cDNA samples were amplified by polymerase chain reaction (PCR) using a DNA thermal cycler (MJ Research) and the following specific human probes from Applied Biotechnologies: LRP5, iNOS, CD80, CD163 and IL1Ra. Normalization was performed against r18S.
6
RNA Isolation and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Tripure Reagent (Roche, Indianapolis, IN, USA) following the manufacturer’s protocol. To analyze mRNA expression of apoptosis-related genes, RT-PCR was performed using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal control. First-strand cDNA was synthesized from 5 μg total RNA at 42 °C for 50 min. The cDNA was amplified in a DNA thermal cycler (MJ Research, Watertown, MA, USA) using the following program: denaturation for 6 min at 95 °C, denaturation for 28 cycles at 35 s and 95 °C, annealing for 35 s at 54 °C, and extension for 45 s at 72 °C, with a final 7-min extension step at 72 °C. PCR products were separated by electrophoresis on 2% agarose gels (PB1200, Bioman Scientific, Taipei, Taiwan) and visualized via ethidium bromide staining. The PCR primers used in this study are presented in Supplementary Table S1 .
7
PCR Protocol for SSR Primer Verification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR reaction was conducted in a total volume of 10 μl (1 μl of template DNA and 9 μl of reaction mixture containing 0.6 μl of each forward and reverse primer, 3.5 μl of master mix, and 4.3 μl of nuclease-free water) in PCR tubes. This reaction was performed in a DNA Thermal Cycler (BIO-RAD) as follows: an initial denaturation step for 4 min at 94˚C; annealing step for 30s at 94˚C and extension step for 1 min at 72˚C followed by 35 cycles. Final extension step followed by 7 min at 72˚C and then the reaction was stored at 4 ˚C for ∞.
Each sample’s PCR product were verified by running it on a 2.5% agarose gel for two hours at 80 V with 10 μl of ethidium bromide in 1X TAE buffer. Additionally, a 100-bp DNA ladder was used as a molecular indicator for determining the size of the SSR primer product. The Gel-Documentation Unit (BIO-RAD) was used to view the gels and took pictures of them.
Each sample’s PCR product were verified by running it on a 2.5% agarose gel for two hours at 80 V with 10 μl of ethidium bromide in 1X TAE buffer. Additionally, a 100-bp DNA ladder was used as a molecular indicator for determining the size of the SSR primer product. The Gel-Documentation Unit (BIO-RAD) was used to view the gels and took pictures of them.
8
Expression Analysis of S-IL-17A and Mb-IL-17A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine the expression of S-IL-17A and Mb-IL-17A mRNAs, total RNA was extracted using a Hybrid-R kit (GeneAll, Korea). 2 μg of total RNA was reverse transcribed using oligo (dT) primers and M-MLV reverse transcriptase (Affymetrix, USA) at 42°C for 1 h. Semi-quantitative PCR was performed using HSTag premix (Geneall, Korea) on a DNA thermal Cycler (Biorad; USA).
9
Quantifying mRNA Expression in Human Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from human neurons 24 hours post OGD with Trizol reagent (Takara Bio Inc., Otsu, Japan). RNA was reverse transcribed to cDNA with the Revert AidTM First Strand cDNA Synthesis kit (Thermo Scientific). qRT-PCR was then performed to detect the relative expression of mRNA according to previous protocols (Liu et al., 2014), with the primer sequences shown in Table 1
10
Quantitative Analysis of piRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were extracted from PAs and PASMCs, respectively, according to the manufacturer's instructions and detected by ultraviolet spectrophotometer. Extracted RNAs were reverse transcribed according to the superscript first‐strand cDNA synthesis kit (Invitrogen). cDNA samples were amplified in a DNA thermal cycler (Bio‐Rad). Conventional real‐time PCR with SYBR Green (Takara) was carried out with total RNA samples as detailed elsewhere.20 The nucleotide sequences of primers (5′‐3′) were as follows:
piR‐rno‐63076,GCAGTACCACAGGGTAGA (forward), GGTCCAGTTTTTTTTTTTTTTTCGT (reverse).
piR‐rno‐62974,CAGCAGTGGTTTTACCCTATG (forward), GGTCCAGTTTTTTTTTTTTTTTCTAC (reverse).
RNU6B (U6), GCTTCGGCAGCACATATACTAAAAT (forward), CGCTTCACGAATTTGCGTGTCAT (reverse).
5S rRNA (5S), TACGTGGATGGGAGACCACCT(forward), CAGTTTTTTTTTTTTTTTAAAGCCTACAGC(reverse).
Acadm, AGTCCTTGGCCCCGAATTGT(forward), TCCGCCACATTCCTCAGTGT(reverse).
β‐actin, AGGGAAATCGTGCGTGAC(forward), CAAGAAGGAAGGCTGGAAAA(reverse).
piR‐rno‐63076,GCAGTACCACAGGGTAGA (forward), GGTCCAGTTTTTTTTTTTTTTTCGT (reverse).
piR‐rno‐62974,CAGCAGTGGTTTTACCCTATG (forward), GGTCCAGTTTTTTTTTTTTTTTCTAC (reverse).
RNU6B (U6), GCTTCGGCAGCACATATACTAAAAT (forward), CGCTTCACGAATTTGCGTGTCAT (reverse).
5S rRNA (5S), TACGTGGATGGGAGACCACCT(forward), CAGTTTTTTTTTTTTTTTAAAGCCTACAGC(reverse).
Acadm, AGTCCTTGGCCCCGAATTGT(forward), TCCGCCACATTCCTCAGTGT(reverse).
β‐actin, AGGGAAATCGTGCGTGAC(forward), CAAGAAGGAAGGCTGGAAAA(reverse).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!