Hiscript 2 q rt supermix for qpcr with gdna wiper

Total RNA was extracted from mouse testes using TRIzol reagent (MRC, TR118) in accordance with the manufacturer's instructions. Nucleic acid quantification and purity are listed in Table S4. Briefly, 1 μg of total RNA was reverse‐transcribed with HiScript II Q RT SuperMix for qPCR with gDNA Wiper (Vazyme, R223‐01). Quantitative RT‐PCR was performed using a CFX96 Real‐Time System (Bio‐Rad) and SYBR Green qPCR Mix (GenStar, A301‐01). The PCR cycling conditions were as follows: 40 cycles of 95°C for 10 seconds (denaturation), 60°C for 10 seconds (annealing) and 72°C for 20 seconds (elongation). Expression levels were normalized to the geometric mean of Gapdh and Actin. The relative expression level of candidate genes was calculated using the formula 2^‐ΔΔCT as described.²⁶ The primers used are listed in Table S1. All experiments were repeated three times.

D. citri larvae of the same age were collected and sprayed with the spore suspension of L. attenuatum at the concentration of 1×10⁸ spores/mL. The infection period lasted 5 days. A proper amount of D. citri was picked out every day, frozen with liquid nitrogen, and preserved at -80°C. D. citri larvae treated with sterile water were used as the control. The primers for differentially expressed genes and reference genes were designed using Primer Premier 5 software (S1 Table). The total RNA from the six treatments above was extracted separately, and 1 μg was used in the reverse transcription with HiScript II Q RT SuperMix for qPCR with gDNA wiper (Vazyme, China), followed by real-time fluorescent quantitative PCR with ChamQ SYBR qPCR Master Mix (Vazyme). The reaction was carried out on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, USA). Relative gene expression was calculated using the Pfaffl method [23 (link)]. Both D. citri α-tubulin and β-actin were used as reference genes. The analytic software for qPCR was 7500 softwear v2.0.6. SPSS Statistics v19.0.0 software was used to perform independent sample t-tests (P<0.05).

Total RNA was isolated using Trizol (Takara, Kyoto, Japan, No.9109) according to the manufacturer’s instructions. RT-PCR was performed using HiScript^® II Q RT SuperMix for qPCR with gDNA wiper (Vazyme, Nanjing, China, R223-01). The qPCR was performed using AceQ qPCR SYBR Green Master Mix (Low ROX Premixed) (Vazyme, Q131-02) on a QuantStudio 12K Flex Real-Time PCR System (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s protocols. Primers are shown in Supplementary Table S2.

RNA extraction was carried out using Fast Pure Cell/Tissue Total RNA Isolation Kit (RC101, Vazyme, Nanjing, China) and cDNAs were synthesized with a HiScript II Q RT SuperMix for qPCR with gDNA wiper (R223, Vazyme, Nanjing, China). Real-time PCR analysis was performed using ChamQ SYBR Color Qpcr Master Mix (Q431, Vazyme, Nanjing, China). Primer sequences are detailed as follows (forward and revers 5′-3′): human GAPDH: GCACCGTCAAGG CTGAGAAC and ATGGTGGTGAAGACGCCAGT, mouse GAPDH: AACGACCCCTTCATTGAC and TCCACGACATACTCAGCAC, RSV-A (N region): CATCCAGCAAATACACCATCCA and TTCTG CACATCATAATTAGGATATCAA, RSV-A (G region): CGGCAA ACCACAAAGTCACA and TTCTTGATCTGGCTTGTTGCA, RSV-A (F region): AACAGATGTAAGCAGCTCCGTTATC and GATTTTTA TTGGATGCTGTACATTT, Mouse IL-1β: GCAACTGTTCCTGA ACTCAACT and ATCTTTTGGGGTCCGTCAACT, Mouse TNF-α: CCCTCACACTCAGATCATCTTCT and GCTACGACGTGGGCTACAG.

Total RNA extraction of intestinal tissue and mucosal cells after centrifugation was performed with Trizol (Invitrogen). RNA was quantified using Nanodrop2000 (Thermo Fisher) and its integrity was checked on a 1% agarose gel. cDNA was synthesized from RNA samples (600 ng) using HiScript^® II QRT SuperMix for qPCR with gDNA wiper (Vazyme). Quantitative real-time PCR (qPCR) was performed on a Bio-Rad CFX Maestro™ (Bio-Rad) instrument with 6ng cDNA per well using Hieff^® qPCR SYBR^® Green Master Mix (Yeasen). The run was 95°C for 5 minutes, then 95°C for 10 seconds, 60°C for 15 seconds, 72°C for 60 seconds with 41 cycles. Each reaction was performed in triplicate. The qPCR analysis was performed according to previously published procedures (38 (link), 39 (link)) with rpl13a serving as the endogenous control. The average ΔCt value was calculated by subtracting the control ΔCt value from the treated ΔCt value. The relative amount of mRNA was calculated as 2^-ΔΔCt. The primers used in the current study were partially cited from published articles or designed and tested using the primer BLAST in NCBI. The primers used are summarized in Table 1.

Cerebral RNA (n = 3) was extracted from 2 litters with different parents. HiScript II Q RT SuperMix for qPCR (with gDNA wiper) (Vazyme, Nanjing, China) was used to reverse transcribed equal amount of RNA of each sample to complementary DNA. Real-time PCR was conducted with AceQ qPCR SYBR^® Green Master Mix (Vazyme, Nanjing, China) on a LightCycler^® 480 (Roche Diagnostics, Basel, Switzerland).
The amplifying conditions for cDNA were as follows: denaturation at 95 °C for 10 min, 45 cycles of 95 °C for 10 s and 60 °C for 30 s, followed by 95 °C for 10 s, 65 °C for 60 s, 97 °C for 1 s and 37 °C for 30 s. Quantitation of the relative levels of mRNA were carried out by the comparative 2^−ΔΔCt method and normalized to Ribosomal Protein S18 (RPS18) levels (B661301, Sangon Biotech, Shanghai, China). Primer sequences are listed in Table 1.