For the generation of ADAM17 knock‐out cells CRISPR/Cas9 technology was used. Two chemically modified guide RNAs (AUCUAAUAUCCAGCAGCAUU; UUUUUCUUACCGAAUGCUGC; Synthego, Redwood City, USA) were complexed with Cas9 protein (PNA BIO, Thousand Oaks, USA) and co‐electroporated (Neon, ThermoFisher, Waltham, USA) into Igrov‐1 cells to target genomic positions in ADAM17 exon 2 (chr2: 9,543,226; chr2: 9,543,228) for double strand breaks. Single cell suspensions were dispensed into 96‐well plates by flow cytometry (FC) sorting (FACS Aria III Fusion, BD). Colony formation of single cells was monitored using the single cell cloning application of the YT‐Software® using NYONE® Scientific Imager (SYNENTEC GmbH, Elmshorn, Germany). Using this methodology, we ensured that only colonies derived from single cells were further analysed. Quantification of soluble AREG—as a surrogate for ADAM17 activity—by AREG enzyme‐linked immunosorbent assay (ELISA) (#DY262 R&D Systems) allowed a pre‐screening of clones with respect to ADAM17 activity. ADAM17 knock‐out was analysed using Western blot (WB) (total ADAM17 expression), conventional FC and imaging FC (ImageStream X Mark II (Merck)) (surface ADAM17 expression). Out of the analysed clones clone B2 performed best in all assays and was selected for the present study.
Facsariaiii fusion
Manufactured by BD
Sourced in United States
The FACSAriaIII Fusion is a high-performance cell sorter developed by BD. It is designed for advanced flow cytometry applications, providing researchers with a powerful tool for precise cell sorting and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Cas9 protein, by PNA Bio (1 mentions)
Imagestream x mark 2, by Merck Group (1 mentions)
Propidium iodide, by Thermo Fisher Scientific (1 mentions)
Live dead fixable aqua dead cell stain kit, by Thermo Fisher Scientific (1 mentions)
Cd27 fitc, by BD (1 mentions)
Cxcr3 bv605, by BD (1 mentions)
Cd62l pe cy7, by BD (1 mentions)
Cd95 pe cy5, by BioLegend (1 mentions)
Cd45 pe cy7, by BioLegend (1 mentions)
Pdgfrα apc, by Thermo Fisher Scientific (1 mentions)
Cd31 pe cy7, by BioLegend (1 mentions)
Ter119 pe cy7, by BioLegend (1 mentions)
Sca1 pe, by Thermo Fisher Scientific (1 mentions)
Chromiumsingle cell gene expression solution, by 10x Genomics (1 mentions)
Sca 1, by BD (1 mentions)
Cx3cr1, by BioLegend (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions)
Cd11b, by BioLegend (1 mentions)
7 protocols using facsariaiii fusion
1
Generation of ADAM17 Knockout Cells using CRISPR/Cas9
2
Cell Cycle Analysis of hiPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WTC edited and unedited parental hiPSCs were cultured as described in Cell culture above, until they reached 50–60% confluency. Cells were dissociated into single-cell suspension using Accutase, collected into 15-ml conical vials, pelleted, and resuspended in 50 µl DPBS. The cells were vortexed while ice-cold 70% ethanol was added dropwise to obtain a final concentration of 106 cells/ml. Cells were fixed overnight at 4°C and then transferred to −20°C until staining. A total of 2 × 105 cells per sample were aliquoted into wells of a round-bottom 96-well plate and centrifuged at 850 × g at 4°C for 10 min. Cells were washed twice with cold DPBS, resuspended in 50 µl Accutase, and incubated at 37°C for 5 min. Propidium iodide/RNase/DPBS working solution (150 µl) was added to each well for a final concentration of 50 µg/ml Propidium iodide (Molecular Probes) and 250 µg/ml RNase (ThermoFisher Scientific). Cells were incubated at 37°C for 30 min, filtered through 35-µm mesh caps (Corning) and acquired on a FACSAriaIII Fusion (BD Biosciences), and analyzed using FlowJo version 10.2 (Treestar). Samples were gated to exclude debris and cell doublets at described in Transfection and enrichment by FACS above, and then singlets were gated for G1 and G2/M based on negative controls. Percent S phase was calculated by subtracting percent G1 and G2/M from 100%.
3
Phenotypic Analysis of PBMC Subsets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thawed PBMCs were reacted with LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Thermo Fisher Scientific, Waltham, MA, USA) to remove the dead cells. For phenotypic analysis, cells were stained with phycoerythrin (PE)-conjugated Tax301-309/HLA-A*24:02 tetramer reagents (MBL, Nagoya, Japan) and several fluorescence-conjugate mouse anti-human monoclonal antibodies (mAbs) [CD3-APC-H7, CD8-Pacific Blue, CD45RA-PerCP5.5, CCR7-Alexa647, CD62L-PE-Cy7, CD27-FITC, CXCR3-BV605 (BD Biosciences), and CD95-PE-Cy5 (Biolegend, San Jose, CA)] for 25 min on ice. Stained cells were washed twice and immediately acquired using FACSAriaIII Fusion (BD Biosciences) equipped with 20 detectors by 4-lasers at 488 nm, 561 nm, 633 nm, and 405 nm. The data were analyzed using FlowJo ver.10 software (BD Biosciences). The experiments requiring cell sorting for TCR repertoire analysis, described below, were carried out using the same equipment.
4
Single-Cell RNA-seq of Murine Mesenchymal Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the initial scRNA-seq experiment was performed using the Chromium Single Cell Gene Expression Solution (10× Genomics), following the manufacturer’s protocol. The MSC was isolated from ten 6-week-old mice (all males). Cells were stained with the anti-mouse antibodies CD31 PE-Cy7, CD45 PE-Cy7 and TER119 PE-Cy7 (Biolegend), Sca-1 PE (eBioscience) and PDGFR-α APC (eBioscience), and 30,000 Lin − Sca-1 + Pdgfr-α + were isolated using a BD Bioscience FACS Aria III Fusion. Cells were washed and resuspended in 250 μl FACS buffer (PBS, 2% FBS, 1 mM EDTA), targeting the required 1000 cells/μl concentration, accounting for a 10–20% loss. We pipetted 9.7 μl cell suspension (concentration of 913 cells/μl, ~ 8800 cells), targeting the recovery of ~ 5000 cells. Single-cell RNA-seq libraries were obtained following the 10× Genomics recommended protocol, using the reagents included in the Chromium Single Cell 3’ v2 Reagent Kit. Libraries were sequenced on the NextSeq 500 v2 (Illumina) instrument using 150 cycles (18 bp barcode + UMI, and 132-bp transcript 3’ end), obtaining ~ 5 × 108 raw reads46 (link),47 (link).
5
Isolation and Characterization of Mouse Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microglia were isolated from mouse brains at 22 weeks of age. For all experiments, samples were pooled from 4 to 6 mice/treatment group. Mice were anesthetized and perfused with ice-cold PBS. Brain regions of interest were dissected and homogenized using mechanical dissociation. Single cell suspensions were obtained using a Dounce homogenizer. A 37/70 Percoll density gradient was used to separate cells from debris and myelin. Following Percoll separation, cells were washed and stained with Cd11B (1:1000, Biolegend), CX3CR1 (1:10,000, Biolegend), CD45 (1:1000, Biolegend), and DAPI (1:10,000, Sigma-Aldrich). All steps were performed in microglia staining buffer (1 X HBSS, 1% BSA and 1 mM EDTA). Cells were sorted in a FACSAria III Fusion flow cytometer (BD Biosciences). Live Cd11B+, CX3CR1+, and CD45 (low) cells were identified as microglia and collected for analysis. The full protocol can be found at protocols.io (https://doi.org/10.17504/protocols.io.kqdg3p7bel25/v1 ).
6
Isolation and Identification of MSCs and HSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were suspended in ice-cold HBSS+ at 1–5 × 107 cells/mL and then stained for 30 min on ice with the following monoclonal antibodies: biotinylated or APC-conjugated PDGFR-α (Cat# 17-1401-81) and c-Kit, PE-conjugated Sca-1 (Ly6A/E. Cat# 12-5981-82), PE-Cy7-conjugated lineage markers (Lin: CD3e (Cat# 25-0031-82), CD11b (Cat# 25-0112-82), B220 (Cat# 25-0460-82), Gr-1 (Cat# 25-5931-82), CD45 (Cat# 25-0451-82)), CD31 (Cat# 25-0311-82), and TER-119 (Cat# 25-5921-82). All monoclonal antibodies were purchased from eBioscience (San Diego, CA, USA). Flow cytometry analysis and sorting were performed using a FACS AriaIII Fusion (BD Biosciences, San Jose, CA, USA). Propidium iodide (PI) fluorescence was measured, and a live cell gate was defined to exclude cells positive for PI. Additional gates for MSCs were defined as positivity for PDGFR-α and Sca-1 and negativity for CD31, CD45, and TER119; HSCs were defined as positivity for c-Kit and Sca-1 and negativity for Lin, according to the fluorescence intensity of the isotype control.
7
Th17 Polarization and Cytokine Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The dLNs were harvested from WT and KO mice at peak of EAU disease. Single cell suspensions were prepared as described above. Cells were counted and cultured with or without IRBP1–20 peptide at a density of 2.5 × 106 cells/mL in 96-well U-bottom plates for 48h at 37 °C. Supernatants was collected for cytokine determination using ELISA (Invitrogen, San Diego, CA, USA) according to the manufacturer’s instructions.
CD4+CD62L+ T cells were sorted from spleen cells by cell sorter (FACSAriaIII Fusion, BD Bioscience). They were stimulated by plate bound anti-CD3 (2 μg/mL) and soluble anti-CD28 (1 μg/mL) antibodies. For Th17 polarization, culture media were supplemented with IL-6 (25 ng/mL), TGF-β (2.5 ng/mL), anti-IFN-γ (10 μg/mL), and anti-IL-4 (10 μg/mL) antibodies. On day 3, cells were pulsed with PMA and ionomycin in the presence of Golgistop for 4 h. The cytokine expression was measured as described by flow cytometry.
CD4+CD62L+ T cells were sorted from spleen cells by cell sorter (FACSAriaIII Fusion, BD Bioscience). They were stimulated by plate bound anti-CD3 (2 μg/mL) and soluble anti-CD28 (1 μg/mL) antibodies. For Th17 polarization, culture media were supplemented with IL-6 (25 ng/mL), TGF-β (2.5 ng/mL), anti-IFN-γ (10 μg/mL), and anti-IL-4 (10 μg/mL) antibodies. On day 3, cells were pulsed with PMA and ionomycin in the presence of Golgistop for 4 h. The cytokine expression was measured as described by flow cytometry.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!