Easypure hipure plasmid maxiprep kit

Manufactured by Transgene

Sourced in China

The EasyPure HiPure Plasmid MaxiPrep Kit is a laboratory equipment product that provides a simple and efficient method for the isolation and purification of high-quality plasmid DNA from bacterial cultures. The kit utilizes a silica-based membrane technology to capture and purify the plasmid DNA, ensuring reliable results.

Automatically generated - may contain errors

Lab products found in correlation

Easypure quick gel extraction kit, by Transgene (2 mentions) Easypure pcr purification kit, by Transgene (2 mentions) E coli dh5a, by Takara Bio (1 mentions) Dual luciferase reporter system, by Promega (1 mentions) Clonexpress ultra one step cloning kit, by Vazyme (1 mentions) Pcdna3, by Takara Bio (1 mentions) Pcdna3, by Vazyme (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Sanprep column dna gel extraction kit, by Sangon (1 mentions) Agencourt rnaclean xp kit, by Beckman Coulter (1 mentions) Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions) Taq dna polymerase, by Transgene (1 mentions) Pmd 18t vector kit, by Takara Bio (1 mentions) Tris 2 carboxyethyl phosphine tcep, by Merck Group (1 mentions) Dna oligomers, by Sangon (1 mentions) Swcnt cooh, by Merck Group (1 mentions) Bspqi, by New England Biolabs (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions)

11 protocols using easypure hipure plasmid maxiprep kit

Plasmid Profiling and Transmission of Fluoroquinolone-Resistant and ESBL-Producing Salmonella Derby

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fluoroquinolone-resistant and ESBL-producing S. Derby isolates were inoculated into 200 mL of Luria-Bertani (LB) broth and cultivated for 12 h with shaking of 150 rpm. Then, the plasmids in 200 mL of broth were extracted by a large-volume preparation method using commercial EasyPure Hipure Plasmid Maxiprep Kit (Transgen, Beijing, China). Plasmid profiles were obtained for each isolate using electrophoresis. A PCR-based plasmid typing method was performed to trace the drug-conferring plasmids using 18 pairs of primers representing FIA, FIB, FIC, HI1, HI2, I1-Ig, L/M, N, P, W, T, A/C, K, B/O, X, Y, F, and FIIA plasmid replicons [16 (link)].
Plasmid transformation into E. coli DH5a (TaKaRa Biotechnology, Dalian, China) was conducted for the extracted plasmids to assess β-lactam resistance dissemmination by plasmid. Transformants were selected on LB agar containing 50 μg/mL ampicillin. The highly resistant S. Derby isolates were also tested for resistance transmission ability among isolates through conjugation experiment with rifampin-resistant E. coli c600 as recipients according to previous literature [17 (link)]. Transconjugants were selected on MacConkey agar plates containing ceftriaxone (16 μg/mL) and rifampin (50 μg/mL).

Xu Z., Song Q., Li C, & Zhan Y. (2019). Characterization of ciprofloxacin-resistant and ESBL-producing Salmonella enteric serotype Derby in Eastern China. BMC Microbiology, 19, 61.

+ Open protocol

+ Expand

Arabidopsis Protoplast-Based Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

We followed the previously reported method^{30 (link)}. Four- to six-week-old Arabidopsis plants were used for protoplast isolation. Arabidopsis protoplasts were prepared according to the Jen sheen’s protocol^{45 (link)}. The plasmids frk1::LUC (firefly luciferase) and 35S::RLUC (Renilla luciferase), which were gifts from Prof. Jianmin Zhou, were prepared with the EasyPure HiPure Plasmid MaxiPrep Kit (TransGen Biotech) and co-transfected into Arabidopsis protoplasts with the ratio of 4:1, respectively. The protoplasts were incubated in the dark at room temperature for 18 h and treated with different MAMPs, including Hag, Hag (ex), and flg22 for 3 h. To study the suppression of subtilomycin, purified subtilomycin (final concentration is 15 μM) was premixed with another group of samples of Hag, Hag (ex), flg22 (Ps), and flg22 (Bs), respectively, and incubated on ice for 10 min before treatment. The added MAMPs were removed, and LUC and RLUC activity was measured by using the Dual-Luciferase Reporter system (Promega, E1910) according to the manufacturer’s instructions.

Deng Y., Chen H., Li C., Xu J., Qi Q., Xu Y., Zhu Y., Zheng J., Peng D., Ruan L, & Sun M. (2019). Endophyte Bacillus subtilis evade plant defense by producing lantibiotic subtilomycin to mask self-produced flagellin. Communications Biology, 2, 368.

+ Open protocol

+ Expand

Overexpression Plasmid Construction and Abalone Injection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The overexpression plasmid was constructed according to the protocols described by Liu et al. [35 (link)]. The sequence of the slc38a9 open reading frame (ORF) was obtained according to the step in Section 2.2.3. Homologous arms of Bam HI region in pcDNA3.1 were added to the slc38a9 by the PCR of the templates of slc38a9 with the forward primer slc38a9-HR-F (5′ cttggtaccgagctcggatccATGGGGAGAGGAAGTCGCA 3′) and the reverse primer slc38a9-HR-R (5′ ccacactggactagtggatccTGTTGTATGGCCGATGATGAGG 3′). The target gene sequence was linked to the pcDNA3.1 digested with the Bam H I enzyme, and then transferred to Trans-T competent cells. The extracted plasmid is sequenced to verify that the sequence is attached to the vector. The bacteria successfully linked to the target gene were expanded by shaking the flask culture overnight, and adequate plasmid was collected using the EasyPure HiPure Plasmid MaxiPrep Kit (TransGen Biotech, Beijing, China). The concentration of the plasmid was eventually diluted to 300 ng/μL.
Abalones (Weight: 19.8 ± 0.3 g) were randomly divided into three groups (6 abalones each group) and injected intramuscularly with 100 μL PBS, pcDNA3.1 or pcDNA3.1-slc38a9. Abalones injected with PBS served as the control group. The muscles of abalone were sampled at 12 h after injection.

Liu Y., Yu H., Guo Y., Huang D., Liu J., Pan M., Wang L., Zhang W, & Mai K. (2021). Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai. Cells, 10(10), 2552.

+ Open protocol

+ Expand

Cloning of FOXO3 Transcription Factor

Check if the same lab product or an alternative is used in the 5 most similar protocols

A PCR product encoding the entire open reading frame (ORF) of foxo3 was cloned into the expression vector pcDNA3.1 (Invitrogen, USA). A single band of 1998 bp corresponding to the expected amplification product was obtained from 2.2. The template of foxo3 was PCR amplified using primers with homology arms to BamHI region in pcDNA3.1 consisting of the forward primer foxo3-bamh1-F: 5’- cttggtaccgagctcggatccATGGCCGAGGCGCAGCTG-3’ and the reverse primer foxo3-bamh1-R: 5’-atggtggcgaccggtggatccGCCAGGTACCCAGCTCTGAGA-3’. The resulting amplicons were purified by gel electrophoresis and extracted using the SanPrep Column DNA Gel Extraction Kit (B110092, Sangon Biotech, China). The pcDNA3.1 plasmid was digested with enzyme BamHI (D1010A, Takara, Japan). The purified resulting amplicons was then ligated into the pcDNA3.1 plasmid using ClonExpress Ultra One Step Cloning Kit (C112-02, Vazyme, China). The plasmid constructed was called pcDNA3.1-foxo3, and construct was confirmed by DNA sequencing. The pcDNA3.1-foxo3 plasmid was then transformed into Trans1-T1 Phage Resistant Chemically Competent Cell. After shake culture overnight, adequate plasmid for transfection was collected using a EasyPure HiPure Plasmid MaxiPrep Kit (EM121-01, TransGen, China).

Pan M., Liu J., Huang D., Guo Y., Luo K., Yang M., Gao W., Xu Q., Zhang W, & Mai K. (2021). FoxO3 Modulates LPS-Activated Hepatic Inflammation in Turbot (Scophthalmus maximus L.). Frontiers in Immunology, 12, 679704.

+ Open protocol

+ Expand

Construction of MTB-Detection Plasmid and crRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The conserved MTB insertion element IS1081 that was selected for use as the target of the MTB-detection assay was cloned into the pUC57 vector to construct recombinant plasmids. After recombinant plasmids were confirmed as correct via sequencing, they were purified using an EasyPure® HiPure Plasmid MaxiPrep Kit (TransGen Biotech, China). Next, plasmid DNA was quantified based on optical density measurements conducted at 260 nm, then DNA copy number was calculated using the formula (6.02 × 10²³) × (ng/μl × 10⁻⁹)/(DNA length × 660) = DNA copy number/μl. The crRNA template was an 84-base-pair single-stranded DNA (ssDNA) consisting of the T7 promoter sequence, repeat sequence and target sequence. To prepare crRNA, double-stranded DNA (dsDNA) was amplified using the 84-base-pair ssDNA template and its flanking primers (Supplementary Table S1). After DNA was extracted with TRIzol Reagent (Invitrogen), the dsDNA product was transcribed overnight at 37°C to generate crRNA using the HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs). Thereafter, the transcription product was treated with DNase I at 37°C for 30 min to degrade the dsDNA template, then the final crRNA product was purified using an Agencourt RNAClean XP kit (Beckman Coulter) according to the manufacturer’s instructions.

Ren W., Zhou Y., Li H., Shang Y., Zhang X., Yuan J., Li S., Li C, & Pang Y. (2023). Development and clinical evaluation of a CRISPR/Cas13a-based diagnostic test to detect Mycobacterium tuberculosis in clinical specimens. Frontiers in Microbiology, 14, 1117085.

+ Open protocol

+ Expand

Cloning and Expression of BVDV Core Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pEGFP-C1 vector was stored in our laboratory. The BVDV 1-NADL strain genome was extracted from virus stock with TRIzol reagent. The core gene was amplified from the coding DNA sequence (CDS) region of the genome using gene-specific primers (Table 1) and subcloned into the Bgl II-EcoR I site of the pEGFP-C1 vector. Plasmids were isolated with an Easy Pure HiPure plasmid MaxiPrep kit (EM111, TransGen Biotech, Beijing, China). Next, the recombinant plasmid pEGFP-C1-core was transformed into Escherichia coli BL21(DE3), and the nucleotide sequences of all constructs were identified by DNA sequencing. Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific, Rockford, IL, USA) was used to transfect plasmids into 293T cells according to the reagent instructions. Cells were visualized using blue light with a wavelength of 470 to 480 nm at 24 h posttransfection. When transfected cells successfully expressed green fluorescence, cell lysates were collected and analyzed by Western blotting.

Wang J., Chen K.Y., Wang S.H., Liu Y., Zhao Y.Q., Yang L., Yang G.H., Wang X.J., Zhu Y.H., Yin J.H, & Wang J.F. (2023). Effects of Spatial Expression of Activating Transcription Factor 4 on the Pathogenicity of Two Phenotypes of Bovine Viral Diarrhea Virus by Regulating the Endoplasmic Reticulum-Mediated Autophagy Process. Microbiology Spectrum, 11(2), e04225-22.

+ Open protocol

+ Expand

Functionalization of Single-Walled Carbon Nanotubes

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemical reagents were from commercial sources and were of analytical grade. pMD18-T-Vector kit was purchased from TaKaRa Bio Inc.; JM109 competent cells and DNA molecular weight Marker were purchased from Beijing Dingguo Biotechnology Co. Ltd.; EasyPure Quick Gel Extraction Kit, EasyPure HiPure Plasmid MaxiPrep Kit, EasyPure PCR Purification Kit and Taq DNA Polymerase were purchased from TransGen Biotech (Beijing). Restriction enzymes (BspQI, BstAPI) and T4 DNA ligase were purchased from New England Biolabs Inc.; KOD -Plus- was purchased from TOYOBO. DNA oligomers were purchased from Sangon Biotech (Shanghai) Co., Ltd.. TCEP (Tris(2-carboxyethyl) phosphine), MCH (6-mercaptohexan-1-ol), and NHS-biotin ((+)-biotin N-hydroxysuccinimide ester) and SWCNT-COOH were purchased from Sigma-Aldrich LLC. Streptavidin was purchased from Promega.

Zhang X., Zhang Y, & Zhang W. (2020). Dynamic topology of double-stranded telomeric DNA studied by single-molecule manipulation in vitro. Nucleic Acids Research, 48(12), 6458-6470.

+ Open protocol

+ Expand

Ovarian Cancer Cell Line Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The OvCa cell lines A2780 and SKOV3 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI 1640 (Gibco, NY, USA) or DMEM (Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS; Biological Industries) and 1% penicillin/streptomycin at 37°C and 5% CO₂. Expression plasmids encoding PTAL were constructed using pcDNA3.1. All plasmids were isolated using an EasyPure HiPure plasmid maxiprep kit (TransGen Biotech, Shanghai, China). An hsa-miR-101 mimic was used in place of miR-101 expression. A chemically modified antisense oligonucleotide (antagomir AMO-101) was used to inhibit miR-101 expression, and a scramble oligonucleotide was used as the NC (miR-NC for miR-101, NC for AMO-101). The miR-101 mimic, inhibitor, and stable NC were purchased from GenePharma (Shanghai, China). For transfection, cells were cultured in 6-well plates until they reached 70%–80% confluence. The cells were then transfected with plasmids using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) based on the manufacturer’s instructions. Six hours after transfection of lncRNA or luciferase vector, cholesterol-modified miR-101 mimic or inhibitor was added and incubated with the cells for 48 h.

Liang H., Yu M., Yang R., Zhang L., Zhang L., Zhu D., Luo H., Hong Y., Yu T., Sun J., Shan H, & Gu Y. (2019). A PTAL-miR-101-FN1 Axis Promotes EMT and Invasion-Metastasis in Serous Ovarian Cancer. Molecular Therapy Oncolytics, 16, 53-62.

+ Open protocol

+ Expand

Aspergillus terreus At-ATA cDNA Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

The At-ATA cDNA from Aspergillus terreus sequence, including the NcoI and XhoI restriction sites, was synthesized by General Biosystems (Chuzhou, China), and the plasmid pET-28a(+) was used for gene cloning and DNA sequencing. All PCR primers were synthesized by Qingke Biology Co., Ltd. (Hangzhou, China). PrimeSTAR^® Max DNA polymerase was obtained from Takara Biotechnology (Dalian, China) for the polymerase chain reaction (PCR). Dpn I, Yeast extract and tryptone were obtained from Thermo Fisher Scientific (Shanghai, China). Dimethyl sulfoxide (DMSO), 1-(R)-PEA and pyruvate were obtained from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). NaCl, NaH₂PO₄, Na₂HPO₄, NaOH, DNA ladder, protein marker, protein loading buffer, kanamycin sulfate, isopropyl-β-d-thiogalactoside (IPTG), Ni-NTA Sefinose (TM) Resin (Settled Resin) kit, SDS-PAGE gel kit, and Modified Bradford Protein Assay Kit were obtained from Sangon (Shanghai, China). E. coli BL21(DE3) Chemically Competent Cell, EasyPure^® HiPure Plasmid MaxiPrep Kit, EasyPure^® Quick Gel Extraction Kit and EasyPure^® PCR Purification Kit were purchased from TransGen Biotech (Beijing, China).

Cao J.R., Fan F.F., Lv C.J., Wang H.P., Li Y., Hu S., Zhao W.R., Chen H.B., Huang J, & Mei L.H. (2021). Improving the Thermostability and Activity of Transaminase From Aspergillus terreus by Charge-Charge Interaction. Frontiers in Chemistry, 9, 664156.

+ Open protocol

+ Expand

Cloning and Characterization of pEGFP-C1-tat

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cloning was carried out by transforming pEGFP-C1-tat (kanamycin resistant) on Escherichia coli DH5α (Research Center of Biotechnology, University Gadjah Mada) by applying the heat shock method. Then, pEGFP-C1-tat was isolated using a maxi plasmid isolation kit (EasyPure HiPure Plasmid MaxiPrep Kit; TransGen Biotech Co., Ltd., China). The isolated pEGFP-C1-tat was evaluated using restriction enzymes (EcoRI and BglII; ThermoFisher Scientific, USA). The polymerase chain reaction (PCR) evaluation was performed using primers EGFP-C: 5′CATGGTCCTGCTGGAGTTCGTG3′ and SV40_PA: 5′GAAATTTGTGATGCTATTGC3′.

Unsunnidhal L., Wasito R., Nugraha Setyawan E.M., Warsani Z, & Kusumawati A. (2021). Potential of polylactic-co-glycolic acid (PLGA) for delivery Jembrana disease DNA vaccine Model (pEGFP-C1-tat). Journal of Veterinary Science, 22(6), e76.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!