6 maleimidohexanoic acid

Manufactured by Merck Group

Sourced in United States

6-maleimidohexanoic acid is a chemical compound commonly used in laboratory settings. It is a maleimide-functionalized carboxylic acid with a 6-carbon alkyl chain. The maleimide group allows for specific conjugation to thiol-containing molecules, making it a useful tool in various bioconjugation applications.

Automatically generated - may contain errors

Lab products found in correlation

5 protocols using 6 maleimidohexanoic acid

Peptide Synthesis and Fluorescent Labeling

Check if the same lab product or an alternative is used in the 5 most similar protocols

For peptide synthesis, amino acid derivatives were obtained from Iris Biotech (Marktredwitz, Germany). Reagents such as N,N’-diisopropylcarbodiimide (DIC), triisopropylsilane (TIS), 1-hydroxybenzotriazole (HOBt), 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), NH₄OAc, palmitic acid, 6-maleimidohexanoic acid, acetic anhydride (Ac₂O), N,N-diisopropylethylamine (DIEA), 2,2,2-trifluoroethanol (TFE), and 5(6)-carboxyfluorescein (Cf) were purchased from Sigma-Aldrich (Budapest, Hungary). Fmoc-Rink Amide MBHA resin was obtained from Merck. Trifluoroacetic acid (TFA), N,N-dimethylformamide (DMF), dichloromethane (DCM), 2-ethoxyethanol (Cellosolv), diethyl ether, and acetonitrile (AcN) were from VWR (Budapest, Hungary).
For the in vitro assays, RPMI-1640 medium, fetal calf serum (FCS), 5(6)-carboxyfluorescein diacetate N-succinimidyl ester (CFSE), concanavalin A (ConA), Mowiol^® 4–88, trypan blue, and trypsin were obtained from Sigma-Aldrich (Budapest, Hungary). Macrophage colony-stimulating factor (M-CSF) was from Shenandoah Biotechnology (Warwick, PA, USA). BBL Löwenstein–Jensen Medium was ordered from Becton Dickinson (Környe, Hungary), HPMI buffer (9 mM glucose, 10 mM NaHCO₃, 119 mM NaCl, 9 mM HEPES, 5 mM KCl, 0.85 mM MgCl₂, 0.053 mM CaCl₂, 5 mM Na₂HPO₄ × 2H₂O, pH = 7.4) was prepared in-house using components obtained from Sigma-Aldrich (Budapest, Hungary).

Horváti K., Pályi B., Henczkó J., Balka G., Szabó E., Farkas V., Biri-Kovács B., Szeder B, & Fodor K. (2019). A Convenient Synthetic Method to Improve Immunogenicity of Mycobacterium tuberculosis Related T-Cell Epitope Peptides. Vaccines, 7(3), 101.

+ Open protocol

+ Expand

Photoactivated Biofunctionalization of Surfaces

Check if the same lab product or an alternative is used in the 5 most similar protocols

6-Maleimidohexanoic acid (90%), 2-furanmethanethiol (98%), 2-thienylmethanethiol, pyrrole-2-carboxylic acid (99%), dichloromethane (DCM) (99.8%), methanol (MeOH) (>99.9%), cysteamine (95%), N-hydroxysuccinimide (NHS) (98%), silver nitrate (99%), formaldehyde (36.5–38%), sodium hydroxide (98%, pellets), hydroxypropyl cellulose (HPC) (Mn=80,000, 99%), antifoam A (100%), tris(2-carboxyethyl)phosphine hydrochloride solution (TCEP) (0.5M) and dimethyl sulfoxide-d6 (99.9%) were all received from Sigma Aldrich (St. Louis, MO). EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) was purchased from Thermo Fisher Scientific (Waltham, MA), and custom 3’-amine/ 5’-FAM modified anti-sense RFP single stranded siRNA (UUGGAGCCGUACUGGAACUUG) were purchased from Sangon Biotech (Shanghai, China). All reagents were used as received. A mounted 405 nm LED light (1500mW) from ThorLabs, Inc. (Newton, NJ) was utilized for photorelease experiments.

Abu-Laban M., Kumal R.R., Casey J., Becca J., LaMaster D., Pacheco C.N., Sykes D.G., Jensen L., Haber L.H, & Hayes D.J. (2018). Comparison of Thermally Actuated Retro-Diels-Alder Release Groups for Nanoparticle Based Nucleic Acid Delivery. Journal of colloid and interface science, 526, 312-321.

+ Open protocol

+ Expand

Synthesis of FAM-tagged miR148b Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

Custom-modified fluorescein amidites (FAM)-tagged oligonucleotides (miR148b: 5’ 6-FAM 2’OMe UCA GUG CAU CAC AGA ACU UUG U C6-NH2 3’) were acquired through Trilink Biotechnologies, LLC. (San Diego, CA). 6-Maleimidohexanoic acid (90%), 2-furanmethanethiol (98%), methanol (>99.9%), isopropanol (>99.9%), dichloromethane (99.8%), N-hydroxysuccinimide (NHS) (98%), silver nitrate (99%), formaldehyde (36.5%-38%), sodium hydroxide (98%, pellets), hydroxypropyl cellulose (HPC, Mn = 80,000, 99%), antifoam A (100%), tris(2-carboxyethyl)phosphine hydrochloride solution (TCEP) (0.5M), were all purchased and used without alteration from Sigma Aldrich (St. Louis, MO). EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride), was purchased from ThermoFisher Scientific (Waltham, MA). Mounted 415nm LED lights from ThorLabs, Inc. (Newton, NJ) were used for photo-release experiments.

Liu Y., Bailey J.T., Abu-Laban M., Li S., Chen C., Glick A.B, & Hayes D.J. (2020). Photocontrolled miR-148b nanoparticles cause apoptosis, inflammation and regression of Ras induced epidermal squamous cell carcinomas in mice. Biomaterials, 256, 120212.

+ Open protocol

+ Expand

Furfuryl Isocyanate Conjugation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Furfuryl isocyanate (Sigma-Aldrich (Saint Louis, MO, USA), 97%), 6-maleimidohexanoic acid (Sigma-Aldrich, 98%), Benzocaine (Sigma-Aldrich, Pharmaceutical Secondary Standard), sodium periodate (NaIO₄, Sigma-Aldrich, 99%), N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC, Sigma-Aldrich, 99%), 4-(dimethylamino)pyridine (DMAP, Sigma-Aldrich, 99%), ethanol (Sigma-Aldrich, anhydrous), N,N-dimethylformamide (Sigma-Aldrich), hydroxylamine hydrochloride (NH₂OH·HCl, Sigma-Aldrich, 99%), hydrochloric acid (HCl, Sigma-Aldrich, 37% aqueous solution), aqueous suspension of cellulose nanocrystals with concentration 10 wt% obtained by sulfuric acid hydrolysis (CNC, University of Maine Process Development) and Hank’s Balanced Salt Solution (HBSS, 1×, without calcium and magnesium ions, Life Technologies, Thermo Fisher Scientific, Carlsbad, CA, USA) were used as received without purification. For dialysis, cellulose-based dialysis bags with a 12 kDa molecular weight cutoff were used.

Morozova S.M, & Korzhikova-Vlakh E.G. (2023). Fibrillar Hydrogel Based on Cellulose Nanocrystals Crosslinked via Diels–Alder Reaction: Preparation and pH-Sensitive Release of Benzocaine. Polymers, 15(24), 4689.

+ Open protocol

+ Expand

Characterization of Cysteine Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols

L-Cysteine, 6-maleimidohexanoic acid, trifluoroacetic acid (TFA), acetonitrile (ACN), methanol (MeOH), and ethanol (EtOH) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Methanol-d₆ was obtained from Merck (Darmstadt, Germany).

Niño-Ramírez V.A., Insuasty-Cepeda D.S., Rivera-Monroy Z.J, & Maldonado M. (2022). Evidence of Isomerization in the Michael-Type Thiol-Maleimide Addition: Click Reaction between L-Cysteine and 6-Maleimidehexanoic Acid. Molecules, 27(16), 5064.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!