The CFX Connect Thermal Cycler is a laboratory instrument used for DNA amplification and analysis. It is designed to precisely control the temperature of samples during the thermal cycling process, which is a crucial step in various molecular biology techniques such as polymerase chain reaction (PCR).
RNA was extracted from P. digitatum cells exposure to citral at various concentrations (0 and 1/2MIC) for 0, 30, 60, and 120 min using the Trizol reagent (Invitrogen, USA) following the manufacturer’s instructions. Two micrograms of DNA-free RNA were used for reverse transcription by M-MLV (Promega, USA) with oligo dT18. RTFQ-PCR was performed on a BIO-RAD CFX Connect Thermal Cycler using FastStart Universal SYBR Green Master (Roche, Switzerland). All primer pairs for expression assays are listed in Table 1. RTFQ-PCR was programmed as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min. The 2-△△CT method was used to quantify the value of every sample using actin gene as an internal reference [27 (link)].
Primer pair sequences designed for validation of differentially expressed genes in CK30 and T30 treatment P. digitatum using Real-time Fluorescence Quantitative PCR (RTFQ-PCR)
Gene ID
Gene name
Primer sequence (5′-3′, forward/reverse)
Unigene6144
Actin
TGCGCTGAACCGAACTGCCGTCGGGAGCCTCGAAGCGCTC
Unigene8313
ERG7
GCGCTGGCGATTGGTCGATG
CAGGCCCAGTTTCCGGGCTCC
Unigene8539
ERG11
CCATCGACCTCGTCCCCGCC
TCGCGCTTGCGGTTTTGGGG
Unigene6797
ERG6
CGCGTGATGCCGCCTTCAAC
TGAGCCTTGCGGGCCTCACG
Unigene5828
ERG3
CAGGCCATGGCCGCAATGCC
GGTGCAGGCCACGGTGGATCC
Unigene8125
ERG5
TCTCGCCATTGGCGGATGCG
TCTCGCCATTGGCGGATGCG
OuYang Q., Tao N, & Jing G. (2016). Transcriptional profiling analysis of Penicillium digitatum, the causal agent of citrus green mold, unravels an inhibited ergosterol biosynthesis pathway in response to citral. BMC Genomics, 17, 599.
RNA of P. digitatum treated with citronellal (0 or 1/2 MIC concentration) for 0, 30, and 60 min was extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The expression levels of the ERG1, ERG2, ERG3, ERG4, ERG5, ERG6, ERG7, ERG9, ERG11 ERG24, ERG25, ERG26, and ERG27 genes were examined using RTFQ-PCR. RTFQ-PCR was performed through a BIO-RAD CFX Connect Thermal Cycler using FastStart Universal SYBR Green Master (Roche, Switzerland) with the following programs: 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s, and at 60 °C for 1 min. Actin gene was used as internal reference, and the samples were quantified by 2−△△CT method [31 (link)]. All primer pairs for expression assays are listed in Table 1. The experiments were repeated with addition of exogenous ergosterol (150 mg/L) to the fungal culture medium.
OuYang Q., Liu Y., Oketch O.R., Zhang M., Shao X, & Tao N. (2021). Citronellal Exerts Its Antifungal Activity by Targeting Ergosterol Biosynthesis in Penicillium digitatum. Journal of Fungi, 7(6), 432.
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required