The largest database of trusted experimental protocols

Cfx connect thermal cycler

Manufactured by Roche
Sourced in Switzerland

The CFX Connect Thermal Cycler is a laboratory instrument used for DNA amplification and analysis. It is designed to precisely control the temperature of samples during the thermal cycling process, which is a crucial step in various molecular biology techniques such as polymerase chain reaction (PCR).

Automatically generated - may contain errors

2 protocols using cfx connect thermal cycler

1

Citral-Induced Transcriptional Profiling of Ergosterol Biosynthesis Genes in Penicillium digitatum

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from P. digitatum cells exposure to citral at various concentrations (0 and 1/2MIC) for 0, 30, 60, and 120 min using the Trizol reagent (Invitrogen, USA) following the manufacturer’s instructions. Two micrograms of DNA-free RNA were used for reverse transcription by M-MLV (Promega, USA) with oligo dT18. RTFQ-PCR was performed on a BIO-RAD CFX Connect Thermal Cycler using FastStart Universal SYBR Green Master (Roche, Switzerland). All primer pairs for expression assays are listed in Table 1. RTFQ-PCR was programmed as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min. The 2-△△CT method was used to quantify the value of every sample using actin gene as an internal reference [27 (link)].

Primer pair sequences designed for validation of differentially expressed genes in CK30 and T30 treatment P. digitatum using Real-time Fluorescence Quantitative PCR (RTFQ-PCR)

Gene IDGene namePrimer sequence (5′-3′, forward/reverse)
Unigene6144ActinTGCGCTGAACCGAACTGCCGTCGGGAGCCTCGAAGCGCTC
Unigene8313ERG7GCGCTGGCGATTGGTCGATG
CAGGCCCAGTTTCCGGGCTCC
Unigene8539ERG11CCATCGACCTCGTCCCCGCC
TCGCGCTTGCGGTTTTGGGG
Unigene6797ERG6CGCGTGATGCCGCCTTCAAC
TGAGCCTTGCGGGCCTCACG
Unigene5828ERG3CAGGCCATGGCCGCAATGCC
GGTGCAGGCCACGGTGGATCC
Unigene8125ERG5TCTCGCCATTGGCGGATGCG
TCTCGCCATTGGCGGATGCG
+ Open protocol
+ Expand
2

Citronellal Modulates Ergosterol Biosynthesis Genes in P. digitatum

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA of P. digitatum treated with citronellal (0 or 1/2 MIC concentration) for 0, 30, and 60 min was extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The expression levels of the ERG1, ERG2, ERG3, ERG4, ERG5, ERG6, ERG7, ERG9, ERG11 ERG24, ERG25, ERG26, and ERG27 genes were examined using RTFQ-PCR. RTFQ-PCR was performed through a BIO-RAD CFX Connect Thermal Cycler using FastStart Universal SYBR Green Master (Roche, Switzerland) with the following programs: 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s, and at 60 °C for 1 min. Actin gene was used as internal reference, and the samples were quantified by 2△△CT method [31 (link)]. All primer pairs for expression assays are listed in Table 1. The experiments were repeated with addition of exogenous ergosterol (150 mg/L) to the fungal culture medium.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!