Power cho medium

Manufactured by Lonza

Sourced in Switzerland

Power-CHO medium is a cell culture medium designed for the growth and maintenance of Chinese Hamster Ovary (CHO) cells. It provides the necessary nutrients and growth factors to support the proliferation and viability of CHO cells in suspension culture.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using power cho medium

CHO Cell Cultivation and IL-12 Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHO-S cells (Invitrogen) were cultivated in PowerCHO medium (Lonza) supplemented with 8 mM Ultraglutamine, HT supplement (GIBCO) and antibiotic-antimycotic solution (GIBCO) at 37°C. For protein production, CHO cells were cultured at 31°C in a 1:1 mixture of PowerCHO medium and ProCHO medium (Lonza) both supplemented as described above. For IL12p40 activity assessment, splenocytes, freshly harvested from C57BL/6 mice were cultured in RPMI 1640 medium (GIBCO) supplemented with 10% foetal bovine serum (FBS) at 37°C, 5% CO₂, 95% humidity.

Bootz F., Venetz D., Ziffels B, & Neri D. (2016). Different tissue distribution properties for glycosylation variants of fusion proteins containing the p40 subunit of murine interleukin-12. Protein engineering, design & selection : PEDS, 29(10), 445-455.

+ Open protocol

+ Expand

Cell Culture Methods for FGFR1-Positive and Negative Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHO-S cells (Thermo Fisher Scientific) were cultured in serum-free Power-CHO medium (Lonza) supplemented with 8 mM L-glutamine (Thermo Fisher Scientific) and 1% penicillin and streptomycin mix (Biowest). The cells were subcultered every 2–3 days at a seeding density of 0.2–0.3 × 10⁶ cells·mL⁻¹. The cells were grown at 37°C with 8% CO₂ in a shaking incubator (140 rpm).
NCI-H520 (lung squamous cell carcinoma, FGFR1-positive), NCI-H1581 (lung large cell carcinoma, FGFR1-positive), and HCC95 (lung squamous cell carcinoma, FGFR1-negative) were obtained from the American Type Culture Collection (ATCC). NCI-H520 and NCI-H1581 were cultured in RPMI 1640 (Gibco) with 10% fetal bovine serum (Biowest) and 1% penicillin and streptomycin mix (Biowest); HCC95 cells were cultured in RPMI 1640 (Gibco) with 10% fetal bovine serum (Biowest), sodium bicarbonate (Gibco), and 1% penicillin and streptomycin mix (Biowest). The cancer cell lines were cultured at 37°C with 5% CO₂.

Jendryczko K., Rzeszotko J., Krzyscik M.A., Szymczyk J., Otlewski J, & Szlachcic A. (2021). Peptibody Based on FGFR1-Binding Peptides From the FGF4 Sequence as a Cancer-Targeting Agent. Frontiers in Pharmacology, 12, 748936.

+ Open protocol

+ Expand

Culturing Various Cell Lines for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHO-S cells were obtained from Thermo Fisher Scientific and cultured in PowerCHO medium (Lonza, Basel, Switzerland) supplemented with 8 mM L-glutamine (Lonza, Basel, Switzerland) and 1% penicillin-streptomycin mix (Biowest, Nuaillé, France) at 37 °C in a humidified incubator with 8% CO₂. U2OS (human bone osteosarcoma epithelial cells), NIH 3T3 (mouse embryo fibroblasts), and NCI-H520 (lung squamous cell carcinoma, FGFR1-positive) were obtained from American Type Culture Collection (ATCC). U2OS cells stably expressing FGFR1 (U2OS-FGFR1) were a kind gift from Dr. Ellen M. Haugsten from the Norwegian Radium Hospital and HCC-15 (lung squamous cell carcinoma, FGFR1-negative) was from Leibniz Institute DSMZ—German Collection of Microorganisms and Cell Cultures. U2OS, NIH 3T3 were cultured in DMEM with 10% FBS and 1% penicillin-streptomycin mix (Biowest, Nuaillé, France), U2OS-FGFR1 was cultured in DMEM with 10% FBS, 1% penicillin-streptomycin mix (Biowest, Nuaillé, France) and 0.2 mg/mL geneticin (Thermo Fisher Scientific, Waltham, MA, USA). HCC-15 and NCI-H520 were cultured in RPMI 1640 (ATCC) with 10% FBS and 1% penicillin-streptomycin mix (Biowest, Nuaillé, France).

Jendryczko K., Chudzian J., Skinder N., Opaliński Ł., Rzeszótko J., Wiedlocha A., Otlewski J, & Szlachcic A. (2020). FGF2-Derived PeptibodyF2-MMAE Conjugate for Targeted Delivery of Cytotoxic Drugs into Cancer Cells Overexpressing FGFR1. Cancers, 12(10), 2992.

+ Open protocol

+ Expand

Constructing the 46F2 small immunoprotein

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to construct the 46F2 small immunoprotein (46F2SIP) gene, the DNA sequence coding for the scFvOC-46F2 [36 (link)] was amplified by polymerase chain reaction (PCR) using Pwo DNA polymerase (Roche Diagnostics, Milan, Italy), according to the manufacturer’s recommendations, with primers BC-512 (ctcgtgtgcactcggaggtgcagctggtggagtct) and BC-513 (ctctccggagcctaggacggtcagcttggt) containing the ApaLI and BspEI restriction sites, respectively. The amplification product was inserted in ApaLI/BspEI in the pcDNA3.1-epsilonCH4 vector, which provides the scFv gene with a secretion signal required for secretion of proteins in the extracellular medium [44 (link)]. This construct was used to transfect Chinese hamster ovary CHO-K1, as previously described [36 (link)]. The different geneticin-selected clones were screened by FACS on SKMEL28 human melanoma cell line for their ability to secrete 46F2SIP. The amplification products for scFv CGS1-A1 anti-B-FN [56 (link)] and for the genomic sequence of the signal secretion leader peptide [37 (link)] were cloned in pcDNA3.1-Myc-His vector and constructs were used for the stable transfection of CHO cell line, as previously reported [36 (link)]. The 100% positive clones were cultured in serum-free power-CHO medium (Lonza) and expanded for antibodies and purification.

Orecchia P., Balza E., Pietra G., Conte R., Bizzarri N., Ferrero S., Mingari M.C, & Carnemolla B. (2019). L19-IL2 Immunocytokine in Combination with the Anti-Syndecan-1 46F2SIP Antibody Format: A New Targeted Treatment Approach in an Ovarian Carcinoma Model. Cancers, 11(9), 1232.

+ Open protocol

+ Expand

Culturing Diverse Cell Lines for Research

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHO-S cells were cultured in Power-CHO medium (Lonza), containing 8 mM Ultraglutamine (Lonza), 4 mM HT-supplement and 1× antibiotic-antimycotic (Gibco) at 37°C. The cells were maintained at densities between 0.5 and 8.0 × 10⁶ cells/mL in a shaking incubator (150 rpm).
In general, the remaining cancer cells were cultured under a 5% CO₂ atmosphere at 37°C. CTLL-2 and transduced reporter CTLL-2 cells [45 (link)] were cultured in RPMI (Gibco) containing 10% FBS (Gibco), 1× antibiotic-antimycotic (Gibco), 2 mM Ultraglutamine (Lonza), 25 mM HEPES (Gibco), 50 μM β-mercaptoethanol (Sigma) and 60 U/mL IL-2 (Proleukin, Roche Diagnostics). F9 teratocarcinoma cells were cultured in flasks coated with 0.1% gelatin (Type B from Bovine Skin, Sigma), and they were cultured in DMEM (Gibco) containing 10% FBS (Gibco) and 1× antibiotic-antimycotic (Gibco). WEHI-164 fibrosarcoma cells were cultured in RPMI (Gibco) containing 10% FBS (Gibco) and 1× antibiotic-antimycotic (Gibco).

Mortensen M.R., Mock J., Bertolini M., Stringhini M., Catalano M, & Neri D. (2020). Targeting an engineered cytokine with interleukin-2 and interleukin-15 activity to the neovasculature of solid tumors. Oncotarget, 11(44), 3972-3983.

+ Open protocol

+ Expand

Culturing CHO-S and CT26 Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHO-S cells were cultured at 37 °C in Power-CHO medium (Lonza) supplemented with 8 M Ultraglutamin (Gibco), 4 M HT (Gibco) and 1% Antibiotic-Antimycotic (Gibco) and kept between 0.5 and 6.0 x 10⁶ cells per mL on a shaking incubator (170rpm).
CT26.wt cells were previously transfected with a plasmid encoding human CAIX, leading to the monoclonal cell line CT26.3E10 expressing human CAIX. Quantification by FACS analysis has revealed that 71’900 copies of the CAIX protein are expressed on one CT26.3E10 cell(30 ). CT26.wt cells and CT26.3E10 cells were cultured in RPMI (Gibco) supplemented with 10 % FBS (Gibco) and 1 % Antibiotic-Antimycotic (Gibco) at 37°C and 5% CO₂. Cells were trypsinized, passaged at a confluency of 80 % and kept in culture for no longer than 15 passages. The wildtype CT26 cell line was obtained from ATCC in 2015. Authentication of the cell line including check of post-freeze viability, growth properties and morphology, test for mycoplasma contamination, isoenzyme assay and sterility test were performed by the cell bank prior to shipment.

Ziffels B., Stringhini M., Probst P., Fugmann T., Sturm T, & Neri D. (2019). Antibody-based delivery of cytokine payloads to carbonic anhydrase IX leads to cancer cures in immunocompetent tumor-bearing mice. Molecular cancer therapeutics, 18(9), 1544-1554.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!