RNA was extracted from frozen tissue samples with Trizol reagent (Invitrogen, Carlsbad, CA). RNA purification was done by DNase1 treatment (Thermo Scientific, Amplification grade). In brief, 1μg of total RNA sample was treated with 10X DNase I reaction buffer and DNase I (1U/10μl) and incubated for 30 min at 37°C followed by inactivation of DNase I with 50 mM EDTA at 65°C for 10 min. RNA was quantified by Qubit 2.0 fluorometer (Molecular Probes, Invitrogen, USA).
Amplification grade
Manufactured by Thermo Fisher Scientific
Sourced in United States
Amplification grade is a high-quality laboratory equipment designed for use in various amplification techniques, such as PCR (Polymerase Chain Reaction). Its core function is to provide consistent and reliable performance in amplifying DNA or RNA samples, ensuring accurate and reproducible results.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (1 mentions)
Quantstudio 7 flex real time pcr system software, by Thermo Fisher Scientific (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Trizol reagent protocol, by Thermo Fisher Scientific (1 mentions)
Transzol, by Transgene (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Power sybr green, by Thermo Fisher Scientific (1 mentions)
Abi prism 7000 system, by Thermo Fisher Scientific (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Reverse transcription system, by Promega (1 mentions)
Cfx manager software, by Bio-Rad (1 mentions)
Abi prism 7300 real time pcr machine, by Thermo Fisher Scientific (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
8 protocols using amplification grade
1
RNA Extraction and Purification
2
Quantitative Real-Time PCR (qPCR) of Mouse Placenta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qPCR) was performed as described previously (49 (link)). Total RNA was extracted from the mouse placenta using the miRNeasy Mini Kit (#217004; Qiagen, Hilden, Germany) according to the manufacturer's instructions. Single-stranded cDNA was prepared using DNaseI, Amplification grade (#18068015; Thermo Fisher Scientific), and SuperScript III First-Strand Synthesis SuperMix (#18080400; Thermo Fisher Scientific) and amplified by PCR according to the manufacturer's instructions. qRT-PCR was performed using PowerUp SYBR Green Master Mix (#A25742; Thermo Fisher Scientific) and a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Each biological sample had four technical replicates for qPCR, and the number of biological replicates for each experiment is indicated in each figure legend. 18S rRNA was used as a reference for normalization. Data were analyzed by the ΔΔCq method using QuantStudio 7 Flex Real-Time PCR System software (Thermo Fisher Scientific). The following primers were used: 18S rRNA, F-5′-GAGGGAGCCTGAGAAACGG-3′, R-5′-GTCGGGAGTGGGTAATTTGC-3′; Hmox1, F-5′-GCCACCAAGGAGGTACACAT-3′, R-5′-CTTCCAGGGCCGTGTAGATA-3′; Nqo1, F-5′-GAAGCTGCA-3′, R-5′-GTTGTCGTACATGGCAGCAT-3′; Cth, F-5′-CTTGCTGCCACCATTACG-3′, R-5′-TTCAGATGCCACCCTCCT-3′; Ptgs2, F-5′-GCTTCGGGAGCACAACAG-3′; R-5′-TGGTTTGGAATAGTTGCTC-3′.
3
RNA Extraction and Purification from Frozen Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from frozen tissue samples with Trizol reagent (Invitrogen, Carlsbad, CA). RNA purification was done by DNase1 treatment (Invitrogen, Amplification grade). In brief, 1μg of total RNA sample was treated with 10X DNase I reaction buffer and DNase I (1U/10μl) and incubated for 15 min at room temperature followed by inactivation of DNase I with 25mM EDTA at 65°C for 10 min. RNA was quantified by Qubit 2.0 fluorometer (Molecular Probes, Invitrogen, USA).
4
Tick DNA and RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ticks were first soaked in 70% ethanol for 15 min and grounded in a separate 1.5 ml tube individually to avoid cross-contamination. The tick samples were incubated with proteinase K for 2 h at 56°C and then boiled at 100°C for 10 min to inactivate proteinase K. After centrifugation, the supernatant was transferred to a fresh sterile microtube, and genomic DNA was extracted using a Genomic DNA Purification Kit (Gentra, United States) according to the instructions of the manufacturer. Total RNA from the tick materials of egg, larva, nymph, male, and female, as well as different tissues, was extracted by using a standard TRIzol reagent protocol (Life Technologies, Invitrogen, Carlsbad, CA, United States), followed by chloroform extraction, precipitation with isopropyl alcohol and ethanol, and DNase I treatment (Amplification Grade; Life Technologies, Invitrogen, Carlsbad, CA, United States). The DNA and RNA samples were stored at –20°C until further use.
5
Transcriptome Analysis of Rice Panicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from young panicles using the kit (TransZol, TransGen Biotech, Cat. No.ET101-01). The extracted RNA was incubated with RNase-free DNase I (Amplification Grade, Invitrogen, Cat. No.18068-015) to eliminate genomic DNA contamination. The first-strand cDNA was synthesized from 2 µg total RNA using the M-MLV reverse transcriptase (Invitrogen, Cat. No.28025013). All the experiments were conducted according to the manufacturer’s instructions with at least three biological replicates. Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed to determine the expression level of the target gene. The rice Ubiquitin gene (LOC_Os03g13170) was used as an internal control. All the RT-PCR primers are listed in Supplementary Data 2 .
6
Quantitative PCR Analysis of RNA Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the harvested UT-SCC-5 and UT-SCC-15 cells was extracted using standard Trizol isolation. After DNAse I treatment (Amplification grade, Invitrogen) mRNAs were reverse transcribed using oligo (dT) primers and the Reverse Transcription System (Promega) according to manufacturer’s protocol starting with 1 μg of RNA in a final volume of 20 μl. Subsequently, quantitative PCR (qPCR) reactions were performed with 10 μl Power SYBR Green (Applied BioSystems), 5 μM primers and 2 μl cDNA in a final volume of 20 μl. The used primer sequences for αB-crystallin are: ATCTTCTTTTGCGTCGCCAG and TTCCCCATGGTGTCTGAGC, and for GAPDH: GATTGAGGTGCATGGAAAAC and AGGACCCCATCAGATGACAG. The fluorescent signal intensities were recorded with the ABI Prism 7000 system (Applied Biosystems). Samples were kept for 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. Data analysis was performed on the CFX96 (Biorad). Analysis was performed with CFX Manager Software (Biorad).
7
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from cells was isolated using Trizol (Thermo Fisher Scientific, Grand Island, NY, USA), according to the manufacturer’s protocol. Approximately 1 μg RNA was DNAse-treated (Amplification grade, Invitrogen) and used for cDNA synthesis using the iScriptTM cDNA synthesis kit (BioRad). Quantitative real-time PCR was performed using iTaqTM Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) in the ABI Prism 7300 Real time PCR machine (Applied Biosystems, Thermo Fisher Scientific, Grand Island, NY, USA). Data were analyzed using the ΔΔCt method. The transcripts of the genes of interest were first normalized to the transcripts of β-actin and then normalized to non-specific siRNA control treated MCF7 cells expressing wild type p53. PRKAA1 Forward Primer 5′-3′: GGA GCC TTG ATG TGG TAG GA, Reverse Primer 5′-3′: TTT CAT CCA GCC TTC CAT TC; ACTB-Forward Primer 5′-3′: ATG GGT CAG AAG GAT TCC TAT GT, Reverse Primer 5′-3′: AAG GTC TCA AAC ATG ATC TGG G.
8
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1 μg) was extracted from 0.5 g of powdered tissue samples using TRIzol reagent (Invitrogen, Carlsbad, California, USA), treated with DNase I, Amplification Grade (Invitrogen), and reverse transcribed into cDNA using the GoScript Reverse Transcription System (Promega, Madison, Wisconsin, USA). The primer sets used are shown in Table 1. Reverse transcription PCR was performed on a 7300 Real-Time PCR System (Applied Biosystems, Foster City, California, USA) using SYBR Green RT-PCR kit from Bio-Rad and the following cycle parameters: 95°C for 3 min and 40 cycles at 95°C for 10 s and 60°C for 30 s. The amplification efficiency was 0.90 to 0.99. After amplification, a melting curve (0.01°C/s) was used to confirm product purity. Results are expressed relative to RPS18 using the 2 ΔΔCt method (Livak & Schmittgen, 2001) . The stability expression of RPS18 among experimental treatments was determined through statistical analysis by Tukey's method at α=0.05 to use RPS18 as a reference gene. No variation of RPS18 expression was observed (p = .845) among experimental treatments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!