Phosphoimage screen

Firstly, Renilla Luciferase (R-Luc) RNA fragment was transcribed from p2LUC plasmid that was linearized with restriction enzyme BamH I by T7 RNA polymerase (Promega, USA) with α-[p³²]-ATP incorporation for 2 h at 37 °C. Then, the 0.9 kb runoff transcript was purified with MicroSpin G-25 columns (GE Healthcare Life science, USA).
For in vitro vhs assay, R-Luc RNA substrates (3 × 10⁵ counts per min) was incubated with RRL translated PrV vhs or only RRL(as a negative control) in vhs assay buffer (80 mM K⁺, 2 mM Mg²⁺, 0.25 mM ATP, 0.1 mM DTT, 1.6 mM Tris–HCl, pH 7.8) at 37 °C. At the indicated time points (0, 15, 30 min), assay products were recovered by RNeasy^® mini kit (QIAGEN, Center Mainz, Germany) and separated on a 1.3% formaldehyde agarose gel. All signals were transferred onto a Hybond-N⁺ membrane (GE Healthcare Bio-Science Corp., Piscataway, NJ, USA) and exposed to a phosphoimage screen (Fuji, Tokyo, Japan) and detected with a Bio-Imaging Analyzer (BAS-2500; Fuji).

Accumulation of reporter gene RNA was detected by Northern blot analysis using probe with sequences complementary to R-luc. Briefly, R-luc probes were generated by PCR with primer set (Rluc-F: TCCGCTAGAGCCACCATGAC and Rluc-R: GGCCCTTCACCTTCACGAAC). The PCR amplification conditions were 95 °C for 5 min followed by 30 cycles of denaturation at 95 °C for 1 min, annealing at 55 °C for 2 min, extension at 72 °C for 2 min, and a final extension at 72 °C for 7 min. Radiolabeled DNA probe was generated by random primer labeling with α-[p³²] dATP.
Total RNA was harvested from cells co-transfected with reporter plasmid pRluc and plasmid expressing wild type (WT) vhs (HSV-1, or PrV), or PrV vhs mutants with deletion of individual boxes by RNeasy^® mini kit (QIAGEN). Subsequently, total RNA was separated on a 1.3% denaturing formaldehyde gel and transferred to a Hybond-N⁺ membrane (GE Healthcare Bio-Science Corp., Piscataway, NJ, USA). Following UV-crosslinking fixation and pre-hybridization (for 1 h at 68 °C in pre-hybridization buffer 0.5 M sodium phosphate, 7% SDS and 1 mM EDTA), the membrane was hybridized with radiolabeled DNA probe at 68 °C overnight. After washing steps, the membrane was exposed to a phosphoimage screen (Fuji, Tokyo, Japan) and detected with a Bio-Imaging Analyzer (BAS-2500; Fuji). The relative Rluc RNA level to mock control was plotted.