All maternal serum samples were aliquoted and stored at − 80 °C until analysis. Commercial immunoassay kits for sFlt-1 and PlGF (R&D systems, Minneapolis, MN, USA), PAPPA2 (Ansh Labs, Webster, TX, USA), and GlyFn (DiabetOmics, Inc., Hillsboro, OR, USA) were used according to manufacturer’s instructions. Inter-assay coefficients of variation for these commercial kits ranged from 1.89–6.65% and the intra-assay coefficients ranged from 2.1–4.5%. Biomarker thresholds for PlGF and sFlt-1 were chosen based on published literature using R&D immunoassays [22 (link)]; abnormal PlGF levels are those < 100 pg/ml and abnormal sFlt-1 levels are those > 7000 ng/ml. The threshold for PAPPA2 > 200 ng/ml was determined from prior biomarker studies (unpublished data). GlyFn threshold > 315 μg/ml were derived from the current dataset which best discriminated cases from non-cases and require additional validation in future studies.
Pappa2
Manufactured by Ansh Labs
Sourced in United States
PAPPA2 is a laboratory instrument designed for the measurement and analysis of protein concentration. It utilizes a spectrophotometric method to determine the absorbance of a sample, which is then used to calculate the protein content.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using pappa2
1
Biomarker Thresholds for Preeclampsia
2
Maternal Serum Biomarker Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All maternal serum samples were aliquoted and stored at −80°C until analysis. Commercial immunoassay kits for sFlt‐1 and PlGF (R&D Systems, Minneapolis, MN, USA) and PAPPA2 (Ansh Labs, Webster, TX, USA) were used according to the manufacturer's instructions. Inter‐assay coefficients of variation ranged from 2 to 8% and the intra‐assay coefficients from 2 to 5%.
3
Comprehensive ELISA and Sequencing Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ELISA was used to determine serum levels of ALS and insulin (BioVendor), IGF1, free IGF1, IGF2, total IGFBP4, and IGFBP5, intact IGFBP3 and IGFBP4, PAPP-A and PAPP-A2 (Ansh Labs, Webster). GH and total IGFBP-3 were measured by chemiluminiscence immunoassays (DiaSorin). All assays were performed according to the manufacturers' instructions and all intra-and inter-assay coefficients of variation were lower than 10%.
Whole-genome sequencing was performed in blood DNA from the index case by CENTOGENE. DNA sequencing and validations were performed by CAP/CLIA, commercially accredited laboratories. The average coverage depth was $30X. A complete illustration of the pipeline, filtration processes, and prioritization steps have been previously published https://pubmed.ncbi.nlm.nih.gov/30202406/. The variant plus 150 bp on either side of each variant in the genomic region were amplified using specific primers PAPPA2 c.2656 FWD, ACTCTCCTCATCTCCCATCTC. PAPPA2 c.2656 REV CAGTGGTCACCAGGGTATAAAG, and bidirectionally sequenced using Sanger sequencing.
Whole-genome sequencing was performed in blood DNA from the index case by CENTOGENE. DNA sequencing and validations were performed by CAP/CLIA, commercially accredited laboratories. The average coverage depth was $30X. A complete illustration of the pipeline, filtration processes, and prioritization steps have been previously published https://pubmed.ncbi.nlm.nih.gov/30202406/. The variant plus 150 bp on either side of each variant in the genomic region were amplified using specific primers PAPPA2 c.2656 FWD, ACTCTCCTCATCTCCCATCTC. PAPPA2 c.2656 REV CAGTGGTCACCAGGGTATAAAG, and bidirectionally sequenced using Sanger sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!