Plenti giii cmv puro vector

Hsa-miRNA-let-7c mimic/negative control mimic and hsa-miRNA-let-7c inhibitor/negative control inhibitor were purchased from Applied Biological Materials (ABM, Canada). The cDNA encoding CCAT1 was PCR-amplified and subcloned into the pLenti-GIII-CMV-Puro vector (ABM, Canada), which was named pLent/CCAT1. The siRNAs specifically targeting CCAT1 were synthesized by ABM (Canada). The siRNA sequences for CCAT1 were si-CCAT1-1, 5′-CCTGGCCCTCTCATCAGAGACTTGACTTA-3′, si-CCAT1-2, 5′-GATGTGTGAGTCCTAATTGAAATGAGGCC-3′, si-CCAT1-3, 5′AGGCAGAAAGCCGTATCTTAATTATTGCA-3′and si-CCAT1-4, 5′TGACTTGATCTTTGAACTTTAGCTCA CCA-3′. Transfections were performed using the Lipofectamine 2000 kit (Invitrogen) according to the manufacturer's instructions.

The cDNA encoding linc-ROR was PCR-amplified and subcloned into the pLenti-GIII-CMV-Puro vector (ABM, Canada), which was named as ROR. The sh-RNA specifically targeting linc-ROR were synthesized by ABM (Canada). The sh-RNA sequence for linc-ROR were sh-ROR-1, 5′-GCCTCTGCACTCTTATGG AAGGAGGAAAT-3′, sh-ROR-2, 5′-AGAGTGAAAGTC CCAGGGCATGTGGGAAT-3′, sh-ROR-3, 5′-GGTGAG AAACCCATTGTTCAGTTCCCTAA-3′, sh-ROR-4, 5′-A CTGAGTTGATGATGGAACAGTAGAGTGG-3′.
For FSCN1 functional analysis, cells were transfected with FSCN1-specific small interfering (sh)RNA (ABM, Canada) or pcDNA3.1-FSCN1 plasmids (ABM, Canada). The sh-RNA sequence for FSCN1 were sh-FSCN1-1, 5′-CGAGGACCGCCTGTCCTGCTTCGCGC AGA-3′, sh-FSCN1-2, 5′-GCCGAGAAGTGGAGCG TGCACATCGCCAT-3′, sh-FSCN1-3, 5′-GACAAGGAC GGCAACGTGACCTGCGAGCG-3′, sh-FSCN1-4, 5′-CT GGAGTTCCGCTCCGGCAAGGTGGCCTT-3′.
Transfections were performed using the Lipofectamine 2000 kit (Invitrogen) according to the manufacturer's instructions. Hsa-miRNA-145 mimic/negative control mimic and hsa-miRNA-145 inhibitor/negative control inhibitor were purchased from Applied Biological Materials (ABM, Canada).