Lipofectamine 3000

Manufactured by Horizon Discovery

Sourced in United States

Lipofectamine 3000 is a cationic lipid-based transfection reagent used for the delivery of nucleic acids, such as plasmid DNA and RNA, into a variety of mammalian cell types. The product is designed to efficiently and safely transfect cells, enabling the study of gene expression, protein function, and other cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions) Blasticidin, by Gemini Bio (2 mentions) Shcon, by Horizon Discovery (2 mentions) Pcmv 8.2 and pcmv vsvg packaging plasmids, by Addgene (2 mentions) Zeocin, by Thermo Fisher Scientific (2 mentions) Polybrene, by Merck Group (2 mentions) On targetplus smartpool sirna, by Horizon Discovery (2 mentions) Human ab serum, by Corning (2 mentions) L glutamine, by Thermo Fisher Scientific (2 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions) Lymphoprep, by STEMCELL (2 mentions) Turbofect in vivo transfection reagent, by Thermo Fisher Scientific (1 mentions) D 001810, by Horizon Discovery (1 mentions) Luciferase reporter assay system, by Promega (1 mentions) Lipofectamine rnaimax, by Horizon Discovery (1 mentions) Quikchange kit, by Thermo Fisher Scientific (1 mentions) Pgl3 basic vector, by Promega (1 mentions) C sirna, by Horizon Discovery (1 mentions) On targetplus non targeting pool d 001810 10 05, by Horizon Discovery (1 mentions) C sirna, by Thermo Fisher Scientific (1 mentions)

10 protocols using lipofectamine 3000

Modulating Cardiac Cell Fate via miR-221/222

Check if the same lab product or an alternative is used in the 5 most similar protocols

H9c2 cells were seeded in a 6-well plate at a concentration of 3 × 10⁵ cells per well and transfected with specific miR-221/222 mimics (100 nM) (Dharmacon, CO, United States) or FAM-labeled mimics (GenePharma, Shanghai, China) or a duplex RNA inhibitor (Dharmacon) using Lipofectamine 3000 reagent according to the manufacturer’s protocol followed by the analysis of ETS-1 and PUMA expression, apoptosis, and hypertrophy. Non-targeting sequences were used as negative controls.
PUMA or ETS-1 knockdown was performed with specific siRNA (1 μM) using Lipofectamine 3000. The downregulation of ETS-1 and PUMA was confirmed by Western blot analysis. In addition, full-length cDNA coding rat ETS-1 and PUMA were purchased from Dharmacon. Transient transfection of H9c2 cells was performed with Lipofectamine 3000 reagent.
In vivo transfection was performed by TurboFect in vivo transfection reagent (Thermo), and miR-221/222 mimics or inhibitors (50 pmole) were prepared at a concentration of 50 μL according to the manufacturer’s instructions. The in vivo transfection process followed the protocol of I/R with ADSC-Exo injection. The 50 μL mixture of mimics or inhibitors was injected uniformly intramuscularly into the border zone of the anterior wall of the left ventricle at five positions.

Lai T.C., Lee T.L., Chang Y.C., Chen Y.C., Lin S.R., Lin S.W., Pu C.M., Tsai J.S, & Chen Y.L. (2020). MicroRNA-221/222 Mediates ADSC-Exosome-Induced Cardioprotection Against Ischemia/Reperfusion by Targeting PUMA and ETS-1. Frontiers in Cell and Developmental Biology, 8, 569150.

+ Open protocol

+ Expand

Retroviral Infection of CRC Cells and Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

For infection of CRC cell lines with pMX-IRES constructs, retroviral particles were generated by transfection of HEK 293GP cells with Lipofectamine 3000 (Invitrogen). After transfection, the cell supernatants were collected and used to infect CRC cells, and the stably transfected cells were selected using puromycin and confirmed by quantitative RT-PCR. Selection for infected cells was done with 12.5 ug/ml Blasticidin (Gemini Bio Products) for over a week. SMARTpool siRNA for DKK3, Antagomir-92a, miR-92a mimic and corresponding control oligonucleotides (Dharmacon) were transfected into CRC cells by using Lipofectamine 3000 according to manufacturer’s protocols. For stable infection of organoids, PMX-IRES GFP constructs were used. The retroviral particles were prepared as mentioned above and concentrated using reterconcentrator (Takara Biosciences). Organoid fragments were prepared following the protocol by (15 (link)) and combined with retroviral solution along with polybrene in a 24-well plate, sealed, and spinoculated at 1800 rpm at 37°C for 1 hr 45 min. Following spinoculation, plate was incubated for 6 hrs at 37°C. This was followed by seeding of infected organoids and 5 days post infection, GFP positive cells were sorted and resuspended in matrigel.

Sehgal P., Lanauze C., Wang X., Hayer K.E., Torres-Diz M., Leu N.A., Sela Y., Stanger B.Z., Lengner C.J, & Thomas-Tikhonenko A. (2021). MYC hyperactivates WNT signaling in APC/CTNNB1-mutated colorectal cancer cells through miR-92a-dependent repression of DKK3. Molecular cancer research : MCR.

+ Open protocol

+ Expand

P2X7R Expression Plasmid Generation and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Generation of pcDNA3.1‐hP2X7R, an expression plasmid for P2X7R, was performed as previously described.²⁵ Lipofectamine 3000 was used to transfect RKO and HCT116 cells using the control pcDNA3.1 or pcDNA3.1‐hP2X7R. pcDNA3.1‐mP2X7R was constructed by cloning murine P2X7R cDNA into the EcoRI and NotI sites of pcDNA3.1. This was followed by the stable transfection of CT26 cells using control pcDNA3.1 or pcDNA3.1‐mP2X7R and Lipofectamine 3000 (Invitrogen, Waltham, MA, USA) according to the prescribed protocols. Zeocin (300 µg/mL; Invitrogen, Waltham, MA, USA) in the medium of CT26‐Con and CT26‐mP2X7R cells was used to select stable transfectants.
Lipofectamine 3000 was utilized for transfection of HEK293T cells with green fluorescent protein (GFP)‐tagged lentiviral (pGIPZ) constructs containing P2X7R shRNA (shP2X7R, 5′‐GGAUCCAGAGCAUGAAUUAUU‐3′) or scrambled shRNA (shCon; Dharmacon, Lafayette, CO, USA) and pCMV‐∆8.2 and pCMV‐VSVG packaging plasmids (Addgene, Watertown, MA, USA). At 72 hours after transfection, viral supernatants were collected, followed by instant infection in the presence of 10 μg/mL polybrene (Sigma‐Aldrich, St. Louis, MO, USA). Puromycin at a concentration of 5 μg/mL was utilized for the selection of the above‐mentioned transfectants, which were subjected to cell sorting, and the top 10%‐20% cells with staining for GFP were collected.

Yang C., Shi S., Su Y., Tong J, & Li L. (2020). P2X7R promotes angiogenesis and tumour‐associated macrophage recruitment by regulating the NF‐κB signalling pathway in colorectal cancer cells. Journal of Cellular and Molecular Medicine, 24(18), 10830-10841.

+ Open protocol

+ Expand

Knockdown of Fgf11 in N41 and N43/5 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

N41 and N43/5 cells were seeded in 6-well plates and transfected with ON-TARGETplus mouse scrambled or Fgf11 siRNA comprised of 4 different siRNAs. Scrambled siRNAs (100 nM; Dharmacon, D-001810–10-10–05) or Fgf11 siRNAs (100 nM; Dharmacon, L-045551–01-0010) were transfected using Lipofectamine 3000 for 48 h following the manufacturer’s instructions.

Cho J.H., Kim K., Cho H.C., Lee J, & Kim E.K. (2022). Silencing of hypothalamic FGF11 prevents diet-induced obesity. Molecular Brain, 15, 75.

+ Open protocol

+ Expand

Murine Hepatocyte and Cell Culture Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary murine hepatocytes were isolated and maintained in DMEM supplemented with 10% FBS as previously described²³ ^,²⁴ (link). HepG2 and HEK293 cells were maintained in DMEM supplemented with 10% FBS. MKL1 promoter-luciferase construct was generated by amplifying genomic DNA spanning the proximal promoter and the first exon (−1585/+114) of MKL1 gene and ligating into a pGL3-basic vector (Promega). FLAG-tagged MKL1²⁵ (link) and GFP-tagged E2F1²⁶ (link) constructs have been previously described. Truncation or point mutation was introduced using a QuikChange kit (Thermo Fisher) and verified by direct sequencing. Small interfering RNAs were purchased from Dharmacon: siPld2#1, 5′-GGUUGAGUCCUGAAAUUUATT-3′, and siPld2#2, 5′-GGAUGUUGGAGUGGUUGUATT-3′. Transient transfection was performed with Lipofectamine LTX (for primary hepatocytes), Lipofectamine 3000 (for HepG2 and HEK293 cells) or Lipofectamine RNAiMax (for all siRNAs). Cells were harvested 24 h after transfection and reporter activity was measured using a luciferase reporter assay system (Promega) as previously described²⁷ .

Zhou J., Sun X., Chen X., Liu H., Miao X., Guo Y., Fan Z., Li J., Xu Y, & Li Z. (2023). Phosphatidic acid-enabled MKL1 contributes to liver regeneration: Translational implication in liver failure. Acta Pharmaceutica Sinica. B, 14(1), 256-272.

+ Open protocol

+ Expand

Silencing of TM9SF4 and HIF-1α in U937 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TM9SF4 gene was silenced with synthesized small interfering ribonucleic acids (siRNA) TM9SF4-siRNA (Sil. Sel. siRNA TM9SF4 human, INV, STD, 5NM, cod. 4392420 from Life Technologies, Italy). 1,5x10⁶ U937 cells were transfected with 100 nM of TM9SF4-siRNA, or non-targeting control siRNA (c-siRNA) (Sil. Sel. siRNA Negative Control, 1.5 NM, cod. 4390843, from Life Technologies, Italy) by using Lipofectamine 3000 according to the manufacturer’s protocol (Life Technologies, Italy). U937(TM9SF4-siRNA)- and U937(c-siRNA)- transfected cells were maintained 48 hrs in culture under normoxia; TM9SF4 downmodulation was controlled at protein level by Western blot analysis.
HIF-1α gene was silenced with synthesized HIF-1α-siRNA (ON-TARGET plus SMART pool siR J004018-10 HIF-1α, from Dharmacon, CO, USA). U937 cells were transfected twice with 100 nM of HIF-1α-siRNA, or non-targeting control siRNA (c-siRNA) (ON-TARGET plus Non-Targeting Pool D-001810-10-05, from Dharmacon, USA) by using Lipofectamine 3000. Following the second transfection, U937(HIF-1α-siRNA)- and U937(c-siRNA)- transfected cells were maintained 24 hrs in culture under hypoxia (1% O₂), as described [46 (link)]. HIF-1α downmodulation was controlled by Western blot analysis of nuclear extracts prepared from U937(HIF-1α-siRNA) cells, as compared to U937(c-siRNA) control cells.

Paolillo R., Spinello I., Quaranta M.T., Pasquini L., Pelosi E., Lo Coco F., Testa U, & Labbaye C. (2015). Human TM9SF4 Is a New Gene Down-Regulated by Hypoxia and Involved in Cell Adhesion of Leukemic Cells. PLoS ONE, 10(5), e0126968.

+ Open protocol

+ Expand

Differentiation and Knockdown of Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) were isolated from de-identified human leukapheresis-processed blood (New York Biologics, Inc.) by centrifugation through Lymphoprep (Stem Cell Technologies.) density gradient. Purified PBMCs were resuspended in serum-free RPMI medium and plated in 12-well or 6-well plates at a density of 5 × 10⁶ cells/ml. Cells were incubated at 37°C for 1–2 hours to allow binding of monocytes to the plates, then the medium and unbound cells were discarded and replaced with RPMI supplemented with 10% FBS, 10% human AB serum (Corning), 2 mM l-glutamine (Invitrogen) and 100U/ml of penicillin/streptomycin (Invitrogen). Monocytes differentiated into macrophages over 7 days at 37°C, with fresh medium replenished every 2–3 days. On day 8, cells were transfected using Lipofectamine 3000 according to the manufacturer's protocol, with 50 pmol/ml of ON-TARGETplus SMART-pool siRNA (GE Dharmacon) to knockdown the respective TFs. On day 10, cells were treated with 10 ng/ml LPS for 4 hours and then harvested in TRIzol and analyzed by RT-qPCR. For each PBMC donor, each experimental condition was performed in three biological replicates.

Santoso C.S., Li Z., Lal S., Yuan S., Gan K.A., Agosto L.M., Liu X., Pro S.C., Sewell J.A., Henderson A., Atianand M.K, & Fuxman Bass J.I. (2020). Comprehensive mapping of the human cytokine gene regulatory network. Nucleic Acids Research, 48(21), 12055-12073.

+ Open protocol

+ Expand

Plasmid Constructs for P2X7R Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Generation of pcDNA3.1-hP2X7R, an expression plasmid for P2X7R, was performed as previously described (25) . Lipofectamine 3000 was used to transfect RKO and HCT116 cells using the control pcDNA3.1 or pcDNA3.1-hP2X7R. pcDNA3.1-mP2X7R was constructed by cloning murine P2X7R cDNA into the EcoRI and NotI sites of pcDNA3.1. This was followed by the stable transfection of CT26 cells using control pcDNA3.1 or pcDNA3.1-mP2X7R and Lipofectamine 3000 (Invitrogen) according to the prescribed protocols. Zeocin (300 µg/mL, Invitrogen) in the medium of CT26-Con and CT26-mP2X7R cells was used to select stable transfectants.
Lipofectamine 3000 was utilized for transfection of HEK293T cells with green uorescent protein (GFP)tagged lentiviral (pGIPZ) constructs containing P2X7R shRNA (shP2X7R) or scrambled shRNA (shCon; Dharmacon) and pCMV-∆8.2 and pCMV-VSVG packaging plasmids (Addgene). At 72 hours after transfection, viral supernatants were collected, followed by instant infection in the presence of 10 μg/mL polybrene (Sigma-Aldrich). Puromycin at a concentration of 5 μg/mL was utilized for the selection of the abovementioned transfectants, which were subjected to cell sorting, and the top 10-20% cells with staining for GFP were collected.

Yang C., shi s., Su Y., Tong J., & Li L. (2020). P2X7R promotes angiogenesis and tumor-associated macrophage recruitment by regulating the NF-κB signaling pathway in colorectal cancer cells.

+ Open protocol

+ Expand

Macrophage Differentiation and Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) were isolated from de-identified human leukapheresis-processed blood (New York Biologics, Inc) by centrifugation through Lymphoprep (Stem Cell Technologies.) density gradient. Purified PBMCs were resuspended in serum-free RPMI medium and plated in 12-well or 6-well plates at a density of 5 × 10 6 cells/ml. Cells were incubated at 37°C for 1-2 hours to allow binding of monocytes to the plates, then the medium and unbound cells were discarded and replaced with RPMI supplemented with 10% FBS, 10% human AB serum (Corning), 2 mM L-glutamine (Invitrogen), and 100U/ml of penicillin/streptomycin (Invitrogen).
Monocytes differentiated into macrophages over 7 days at 37°C, with fresh medium replenished every 2-3 days. On day 8, cells were transfected using Lipofectamine 3000 according to the manufacturer's protocol, with 50 pmol/ml of ON-TARGETplus SMARTpool siRNA (GE Dharmacon) to knockdown the respective TFs. On day 10, cells were treated with 10 ng/ml LPS for 4 hours and then harvested in TRIzol and analyzed by RT-qPCR. Each experimental condition was performed in three biological replicates.

Santoso C., Li Z., Lal S., Yuan S., Gan K., Agosto L., Liu X., Pro S.C., Sewell J., Henderson A.J., Atianand M., & Bass J.F. (2020). Comprehensive mapping of the human cytokine gene regulatory network.

+ Open protocol

+ Expand

Retroviral Infection of Colorectal Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For infection of CRC cell lines with pMX-IRES constructs, retroviral particles were generated by transfection of HEK 293GP cells with Lipofectamine 3000 (Invitrogen). After transfection, the cell supernatants were collected and used to infect CRC cells, and the stably transfected cells were selected using puromycin and confirmed by quantitative RT-PCR. Selection for infected cells was done with 12.5 ug/ml Blasticidin (Gemini Bio Products) for over a week. SMARTpool siRNA for DKK3, Antagomir-92a, miR-92a mimic and corresponding control oligonucleotides (Dharmacon) were transfected into CRC cells by using Lipofectamine 3000 according to manufacturer's protocols. For stable infection of organoids, PMX-IRES GFP constructs were used. The retroviral particles were prepared as mentioned above and concentrated using reterconcentrator (Takara Biosciences). Organoid fragments were prepared following the protocol by (15) and combined with retroviral solution along with polybrene in a 24-well plate, sealed, and spinoculated at 1800 rpm at 37 0 C for 1 hr 45 min. Following spinoculation, plate was incubated for 6 hrs at 37 0 C. This was followed by seeding of infected organoids and 5 days post infection, GFP positive cells were sorted and resuspended in matrigel.

Sehgal P., Lanauze C., Wang X., Hayer K.E., Torres-Diz M., Sela Y., Stanger B.Z., Lengner C.J., & Thomas‐Tikhonenko A. (2021). MYC hyperactivates WNT signaling in APC/CTNNB1-mutated colorectal cancer cells through miR-92a-dependent repression of DKK3.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!