The largest database of trusted experimental protocols

Geneticin g418

Manufactured by Selleck Chemicals
Sourced in United States, China

Geneticin (G418) is a broad-spectrum antibiotic used as a selectable marker in genetic engineering and cell culture applications. It inhibits protein synthesis in eukaryotic cells, allowing for the selection of cells that have been successfully transfected with a gene of interest.

Automatically generated - may contain errors

2 protocols using geneticin g418

1

Generating shRNA Plasmids for RNASET2 Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
To construct shRNA plasmids, the shRNA oligo for shRNASET2 (forward sequence 5′‐GCAAGAGAAAUUCACAAACUGCAGC‐3′ and reverse sequence 5′‐GCUGCAGUUUGUGAAUUUCUCUUGCUU‐3′) and control shRNA (forward sequence 5′‐CUUCCUCUCUUUCUCUCCCUUGUGA‐3′ and reverse sequence 5′‐UCACAAGGGAGAGAAAGAGAGGAAGGA‐3′) [28 (link)] were cloned into the pGPU6/GFP/Neo vector (GenePharma, Shanghai, China) according to the manufacturer's instruction. ccRCC cell line 786‐O cells or 769‐P cells were transfected with RNASET2 shRNA plasmids or control shRNA plasmids using HighGene transfection reagent (Abclonal, Wuhan, China) and selected for 2 weeks in 500 μg·mL−1 Geneticin (G418; Selleck, Houston, TX, USA). Subsequently, the selected cells were cultured in 200 μg·mL−1 G418.
+ Open protocol
+ Expand
2

Lentiviral Overexpression and Knockdown of Key Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flag-CRIP1, empty vector and shRNA plasmids were purchased from Youbio Biological Technology (Changsha, China). The full-length coding sequence of CRIP1 was inserted into pCDH-EF1-MCS-T2A-Puro. shRNAs targeting CRIP1, PSME4 and USP7 were purchased from OBiO Technology (Shanghai, China). Endotoxin-free transfection-grade plasmid DNA was amplified in E. coli DH5α Competent Cells (Sangon Biotech, Shanghai, China) and purified with the EndoFree Midi Plasmid Kit (TIANGEN, Beijing, China). Lentiviruses were constructed using psPAX2 and pMD2G and transfected into HEK293T cells with Lipofectamine 3000 (Invitrogen, USA), harvested after 48 or 72 h, and concentrated through ultracentrifugation (20,000×g, 2.5 h, 4 °C). The lentivirus was added to 1 × 106 cells along with 8 mg/mL polybrene in a 12-well plate, and stable cells were selected after 72 h using puromycin (60210es25, Yeasen, China) and geneticin (G418; Selleck, USA). The levels of CRIP1 were confirmed using RT-qPCR and western blotting. shRNA sequences are listed as follows: CRIP1-shRNA (5′-AGCACGAAGGCAAACCCTACT-3′); PSME4-shRNA (5′-GCAACTAGTAAATCTCTTTGC-3′); and USP7-shRNA (5′-GTGTCCTATATCCAGTGTAAA-3′).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!