Rat ASCT2 (kindly provided by S. Bröer) and human ASCT2 (Origene) and YFP complementary DNAs were used to transiently co-transfect sub-confluent human embryonic kidney (HEK 293) cells using POLYPLUS Jet-prime transfection reagent according to the instructions of the supplier. Cell analyses were performed 24–30 hours after transfection using electrophysiological techniques. Tested compounds were purchased from Alfa Aesar and BAC unless otherwise stated.
Polyplus jet prime transfection reagent
Manufactured by Polyplus Transfection
Sourced in France
POLYPLUS Jet-prime transfection reagent is a cationic lipid-based reagent designed for efficient delivery of nucleic acids, including plasmid DNA, mRNA, and siRNA, into a variety of cell types for transient transfection applications.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using polyplus jet prime transfection reagent
1
Transient Co-Transfection of ASCT2 in HEK 293 Cells
2
Transient Transfection of HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat ASCT2 (rASCT2; Bröer et al., 1999 (link)), EAAT1 and YFP complementary DNAs were used to transiently cotransfect subconfluent human embryonic kidney 293 (HEK293) cells with POLYPLUS Jet-prime transfection reagent, according to the instructions from the supplier. Human ASCT2 (hASCT2) complementary DNA was obtained from Genecopoeia. Cells were analyzed using electrophysiological techniques 24–30 h after transfection.
3
Silencing YB1 Expression using siRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The small interfering RNAs (siRNAs) and the control siRNA (siNC) were purchased by RiboBio Technology, Guangzhou, China. The following siRNAs were generated: siYB1-1: GACGGCAATGAAGAAGATAA; siYB1-2: GTTCAATGTAAGGAACGGAT; and siYB1-3: GGTTCCCACCTTACTACAT. The siNC was secretive and not public by company. Transfection was performed with 70 nM siRNAs per sample using polyplus jetPRIME transfection reagent (Polyplus, France).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!