To examine the interactions of MRS221–900 and the MRS–AIMP3 complex with tRNA, pull-down assays were performed using Ni-NTA resin. Yeast total tRNA (Sigma-Aldrich) was subjected to a pull-down assay with hexa-His-tagged proteins immobilized on Ni-NTA resin. A 2.5 nmol aliquot of each protein was bound to Ni-NTA resin and washed several times with buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl). The pull-down assay was performed by adding 1.25 mg yeast tRNA, and resin was washed three times with buffer. The protein and bound tRNA were eluted with buffer containing 200 mM imidazole. UV absorption spectra of the eluted samples and buffers were measured by wavelength scanning from 320 to 230 nm using a UV-1800 UV spectrophotometer (Shimadzu). The amount of tRNA and protein was analyzed by measuring the absorbance at 260 and 280 nm. Synthesized RNA with an elongator tRNAMet sequence labeled with 6-carboxyfluorescein (6-FAM) was purchased from Integrated DNA Technologies and used for the pull-down assay. The amount of RNA eluted was estimated by fluorescence at wavelengths of 495 nm and 517 nm for excitation and emission, respectively.
Yeast total trna
Manufactured by Merck Group
Yeast total tRNA is a laboratory product that contains a mixture of transfer RNA (tRNA) molecules isolated from the cells of the yeast Saccharomyces cerevisiae. tRNA molecules are essential components of the cellular machinery responsible for protein synthesis. The product provides a source of tRNA for various experimental applications in molecular biology, biochemistry, and related fields.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using yeast total trna
1
Probing tRNA Interactions with MRS Complexes
2
Detecting RNA-Protein Interactions by EMSA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect RNA–protein interactions by EMSA, recombinant NSP1 or pure human 40S, 60S, and 80S ribosomal fractions were incubated with 50 fmol of 5′ 32P-labeled RNA transcripts. Briefly, proteins and RNA were mixed with 20 µg of yeast total tRNA (Merck Sigma-Aldrich) and incubated for 20 min in 10 mM Tris–HCl (pH 7.5), 50 mM KCl, 1 mM DTT, 10% glycerol in 20 µL at 0°C. The RNA–protein complexes were analyzed by electrophoresis on native 5% polyacrylamide gels using Tris-50 mM glycine as buffer system and visualized by phosphor imaging.
3
RNA Modification and Footprinting Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Modification by DMS was performed on 2 pmoles of each RNA (Hoxa3 TIE and Hoxa11 TIE). The RNA is first incubated for 15 min in DMS buffer (50 mM Na cacodylate [pH 7.5], 5 mM MgCl2, and 100 mM KCl) and 1 μg of yeast total tRNA (Sigma- Aldrich) and then modified with 1.25% DMS reagent (diluted with ethanol 100%) with 10 min incubation at 20°C and stopped on ice. Modified transcripts were precipitated with 0.25 M NaCl, 0.1 mg/ml glycogen in ethanol. RNA pellets were dried and resuspended in autoclaved milli-Q water. Modified nucleotides were detected by primer extension arrests that were quantified. The intensity of the RT stops is proportional to the reactivity for each nucleotide.
4
RNA Chemical Probing with DMS and CMCT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Modification by Dimethyl Sulfate (DMS) was performed on 2 pmoles of each RNA (TIE a3 and TIE a11) . The RNA is first incubated for 15 min in dimethylsufate (DMS) buffer (50 mM Na Cacodylate (pH 7.5), 5 mM MgCl 2 and 100 mM KCl) and 1 µg of yeast total tRNA (Sigma-Aldrich®) and then modified with 1.25% DMS reagent (diluted with ethanol 100%) with 10 min incubation at 20°C and stopped on ice. Modified transcripts are precipitated with 0.25 M NaCl, 0.1 mg/ml glycogen in ethanol. RNA pellets were dried and resuspended in autoclaved milli-Q water. Modified nucleotides were detected by primer extension arrests that were quantified. The intensity of the RT stops is proportional to the reactivity for each nucleotide.
-Probing with CMCT Similarly, modification by 1-cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-ptoluene sulfonate (CMCT) was performed on 2 pmoles of each RNA (TIE a3 and TIE a11).
Each RNA is incubated for 20 min in CMCT buffer (50 mM Na borate (pH 8.5); 5 mM MgCl 2 ; 100 mM KCl) and 1 µg of yeast total tRNA. Then modifications were performed with 10.5 g/L CMCT reagent with 20 min incubation at 20°C and stopped on ice. Modified transcripts are precipitated with 0.25 M NaCl, 0.1 mg/ml glycogen in ethanol. RNA Pellets were dried and resuspended in autoclaved milli-Q water. Modified nucleotides were detected
-Probing with CMCT Similarly, modification by 1-cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-ptoluene sulfonate (CMCT) was performed on 2 pmoles of each RNA (TIE a3 and TIE a11).
Each RNA is incubated for 20 min in CMCT buffer (50 mM Na borate (pH 8.5); 5 mM MgCl 2 ; 100 mM KCl) and 1 µg of yeast total tRNA. Then modifications were performed with 10.5 g/L CMCT reagent with 20 min incubation at 20°C and stopped on ice. Modified transcripts are precipitated with 0.25 M NaCl, 0.1 mg/ml glycogen in ethanol. RNA Pellets were dried and resuspended in autoclaved milli-Q water. Modified nucleotides were detected
5
MMTV Packaging Signal RNA Structure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hSHAPE experiments [64 –66 ] were performed on in vitro transcribed RNAs corresponding to nucleotides 1 to 713 using benzoyl cyanide (BzCN) and following the protocol described previously [25 ,33 ,57 ]. Briefly, RNAs were modified in a buffer favoring gRNA dimerization (50 mM sodium cacodylate (pH 7.5), 300 mM KCl and 5 mM MgCl2) in the presence of 2 µg total yeast tRNA (Sigma Aldrich). The modified RNAs were reverse transcribed using AS primers OTRs 9 and 10: (5ʹ AACAGATTTGGCTTCTGCGG 3ʹ; MMTV nt 614–633) labelled with VIC or NED, respectively. These primers allowed analysis of the RNA structure from approximately nucleotide 560 to 100. The primer extension products were loaded onto an Applied Biosystems 3130xl genetic analyzer and the electropherograms were analyzed with the QuShape software [67 ]. The hSHAPE reactivities obtained with QuShape from three independent experiments were highly reproducible. These reactivities were averaged (Supplemental Table 2) before being used as constraints to fold the RNA secondary structure of the MMTV packaging signal with the RNAstructure software version 5.3 [68 ] to determine the effects of mutations on the overall higher order structure. Based on the RNAstructure data, the SL4 sub-region of WT and mutants RNAs were drawn using the Assemble graphical tool [69 ].
6
hSHAPE RNA Modification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For hSHAPE modification, 2 pmol of RNA in 8 µL of Milli-Q water was denatured at 90°C and chilled on ice for 2 min. RNA was folded by the addition of 2 µL of 1× dimer buffer (30 mM HEPES, pH 8, 300 mM KCl, 5 mM MgCl2) followed by incubation for 20 min at 37°C. To each sample, 2 µg of total yeast tRNA (Sigma-Aldrich) in 1× dimer buffer was added, and the mixture was incubated for 10 min at room temperature. This was followed by treating the reaction mixture with 3 µL of a 300 mM BzCN solution in anhydrous DMSO for 1 min at room temperature to modify the RNA, and the reaction was stopped by adding 82 µL water. The negative control samples were treated in a similar fashion but using only DMSO without any BzCN. All samples were precipitated by the addition of three volumes of cold ethanol (−20°C), 1 µg of glycogen, and 1/10 volume of 3 M sodium acetate (pH 5) for 30 min in a dry ice/ethanol bath. The resulting precipitates were collected by centrifugation at 13,000 revolutions per minute (rpm) for 30 min at 4°C using a tabletop microfuge. The RNA pellets were washed twice with cold 80% ethanol, air dried, and resuspended in 7 µL of Milli-Q water.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!