Q7 real time pcr system

Total cellular RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. RNA was further purified by DNAase treatment and removal kit (Ambion, Austin, TX, USA). RNA samples (1 μg each) were then reverse-transcribed into cDNA using a SuperScript III First-Strand Synthesis kit (Invitrogen) according to the manufacturer’s instructions. Real-time PCR was performed on a 7500 or Q7 real-time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq with ROX (Bio-Rad, Hercules, CA, USA). Relative gene expression levels were normalized to β-actin and calculated as 2^-ΔΔCT. The sequences of the primers used are listed in Table 1.

Total RNA was extracted from dissected tissues or cultured cells using Trizol reagent (Invitrogen, 15596-018), according to the manufacturer’s instructions. RNA was further purified by DNAse treatment and removal kit (Ambion, AM1906). Equal amount of total RNA was subjected to reverse transcription using SuperScript III First-Strand Synthesis kit (Invitrogen, 18080-051) as instructed. Real-time PCR was performed on a 7500 or Q7 real-time PCR system (Applied Biosystems) by using SYBR Premix Ex Taq with ROX (Takara, RR820B). For real-time PCR, primers used for gene expression are listed below: Dmp1, GGTGATTTGGCTGGGTC, TGTGGTCACTATTTGCCTGT; Gapdh, CCTCGTCCCGTAGACAAAATG, TCTCCACTTTGCCACTGCAA, Aqp4, TTTGGACCCGCAGTTAT, AAGGCGACGTTTGAGC;
The mRNA expression level was normalized to housekeeping gene GAPDH. Results are shown as mean ± SEM.

The total RNA was extracted from samples of fungal inoculated leaves using the optimized extraction procedure described by Zhang et al. (2014) (link).
The SYBR Green Premix Ex Taq™ II quantitative PCR system (Takara, Dalian) was used for qPCR analysis. All experiments involving q-PCR were performed on a Q7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The actin gene (GenBank: aK458277.1) was used as the reference gene. The PCR reaction and program were modified according to the manual. The PCR reaction (a total reaction volume of 10 µL) comprised 5 µL 2 × SYBR Green PCR Master Mix, 3 µL of the cDNA product, 1 µL of primer mix, and 1 µL of DNase/RNase-free water. The quantitative PCR thermal cycler program included 95 °C for 10 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 31 s. All primers for q-PCR were synthesized by the same company (AoKe, Yangling) (Table S4).

Total RNA was extracted from all samples using a MiniBEST Plant RNA Extraction Kit (TaKaRa). First-strand cDNA was synthesized using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa). qRT-PCR was performed using TB Green™ Premix Ex Taq™ II (TaKaRa) on a Q7 Real-Time PCR System (Applied Biosystems™, Foster City, CA, USA) following the manufacturer’s instructions. The primers for qRT-PCR analysis were designed using Primer3 software (version 4.1.0, https://primer3.ut.ee/) based on the CDSs of the identified FtPLATZ genes obtained from TBGP, and the information of all primer sequences are listed in Table S7. FtH3 was selected as the internal reference gene, which has been proven to be stably expressed in Tartary buckwheat under any condition [58 (link)]. Expression data were analyzed using the 2^−ΔΔCT method [59 (link)].

For RNA-seq analysis, 7 dpa hearts were dissected, and the apical portions of 6-8 ventricles were collected in each group. RNA samples were extracted using TRIzol Reagent (Invitrogen, #15596018). Next generation sequencing library construction and sequencing was performed by GENEWIZ Company, Suzhou on an Illumina HiSeq sequencer. Reads from the sequenced samples were qualified and aligned to zebrafish transcriptome (Ensembl genebuild GRCz10.86) using Hisat2 (v2.0.1). Differentially expressed genes were analyzed using the DESeq Bioconductor package, genes identified with altered expression levels with a Benjamini and Hochberg adjusted p-value < 0.05 were retained. GO-TermFinder was used to define Gene Ontology terms. For quantitative RT-PCR analysis (qPCR), RNA samples were extracted from ventricular apices, border zone and atrium at specific time points, respectively, 6-8 samples were pooled together for each group, cDNA was synthesized using the SuperScript^TM III First-Strand Synthesis System (Invitrogen, #18080051) following the manufacturer’s instructions. q-PCR was performed on a Q7 Real-Time PCR System (Applied Biosystems) using SYBR Green ROX dye (Applied Biosystems, #A25742). Primers used are listed in Supplementary Table S4.