The largest database of trusted experimental protocols

Nanog

Manufactured by Bioneer

NANOG is a laboratory instrument designed for the analysis and manipulation of nucleic acids, such as DNA and RNA. It functions as a high-performance thermal cycler, a device used to amplify and process genetic material through the Polymerase Chain Reaction (PCR) technique. NANOG provides precise temperature control and customizable thermal cycling programs to facilitate various molecular biology applications.

Automatically generated - may contain errors

5 protocols using nanog

1

RNAi Knockdown of Pluripotency Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic siRNAs specific for GFP, SCP3, NANOG were purchased from Bioneer; nonspecific GFP, 5- GCAUCAAGGUGAACUUCAA-3 (sense), 5-UUGAAGUUCACCUUGAUGC-3 (antisense); SCP3 #1 5-CAGUUAUAUGAGCAGUUCAUAAA-3 (sense); 5- UUUAUGUUCUGCUCAUAUAACUG-3 (antisense); SCP3 #2 5-GAGACUAGAAAUGUAUACCAAGG-3 (sense); 5-CCUUGGUAUACAUUUCUAGUCUC-3 (antisense); SCP3 #3 5-GUGCAGAAUAUGCUGGAAGGAGU-3 (sense); 5-ACUCCUUCCAGCAUAUUCUGCAC-3 (antisense); NANOG, 5- GCAACCAGACCUGGAACAA-3 (sense), 5-UUGUUCCAGGUCUGGUUGC-3 (antisense). For AKT (#001014431.1) and cyclin D1 (#053056.2), predesigned siRNAs were purchased commercially from Bioneer. siRNA was transfected in vitro into 6-well plates at a dose of 200 pmol per well using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
2

Synthetic siRNAs for GFP, HSP90AA1, and NANOG

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic small interfering RNAs (siRNAs) specific for GFP, HSP90AA1, and NANOG were purchased from Bioneer (Korea); Non-specific GFP (green fluorescent protein), 5′-GCAUCAAGGUGAACUUCAA-3′ (sense), 5′-UUGAAGUUCACCUUGAUGC-3′ (antisense); HSP90AA1#1, 5′-CACCAAACAUAACGAUGAU-3′ (sense), 5′-AUCAUCGUUAUGUUUGGUG-3′ (antisense); HSP90AA1#2, 5′-UGAAGGAGAUGACGACACA-3′ (sense), 5′-UGUGUCGUCAUCUCCUUCA-3′ (antisense); HSP90AA1#3, 5′-GGCACCUGUUAACUGGUACCA-3′ (sense), 5′-UGGUACCAGUUAACAGGUGCC-3′ (antisense); NANOG, 5′-GCAACCAGACCUGGAACAA-3′ (sense), 5′-UUGUUCCAGGUCUGGUUGC-3′ (antisense). For stable knockdown of HSP90AA1, the following complementary oligonucleotides were annealed and cloned into BamHI/HindIII-digested pSilencer 3.1-H1 puro vector (Ambion Inc., Austin, TX): shHSP90AA1#1, 5′-GATCCGCACCAAACATAACGATGATTTCAAGAGAATCATCGTTATGTTTGGTGTTTTTTGGAAA-3′ (sense), 5′-AGCTTTTCCAAAAAACACCAAACATAACGATGATTCTCTTGAAATCATCGTTATGTTTGGTGCG-3′ (antisense); shHSP90AA1#2, 5′- GATCCGTGAAGGAGATGACGACACATTCAAGAGATGTGTCGTCATCTCCTTCATTTTTTGGAAA-3′ (sense), 5′-AGCTTTTCCAAAAAATGAAGGAGATGACGACACATCTCTTGAATGTGTCGTCATCTCCTTCACG-3′ (antisense).
+ Open protocol
+ Expand
3

siRNA Knockdown of GFP, NANOG, CD46, CD55, and CD59

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic small interfering RNAs (siRNAs) specific for green fluorescent protein (GFP), NANOG, CD46, CD55, and CD59 were purchased from Bioneer (Korea); Non-specific GFP, 5’-GCAUCAAGGUGAACUUCAA-3’ (sense), 5’-UUGAAGUUCACCUUGAUGC-3’ (antisense); NANOG15 (link), 5’-CUAAACUACUCCAUGAACA-3’ (sense), 5’-UGUUCAUGGAGUAGUUUAG-3’ (antisense); CD46, 5’-CACCUUUAGUGAAGUAGAA-3’ (sense), 5’-UUCUACUUCACUAAAGGUG-3’ (antisense); CD55, 5’-GUCUCACCAACUUCUCAGA-3’ (sense), 5’-UCUGAGAAGUUGGUGAGAC-3’ (antisense); CD59, 5’-CUCCAAUGACCACCUACUA-3’ (sense), 5’-UAGUAGGUGGUCAUUGGAG-3’ (antisense).
+ Open protocol
+ Expand
4

Quantitative Analysis of Cardiac and Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from MSC was extracted with TRIzol reagent (Life Technologies, CA, USA), and the RNA samples were converted into complementary DNA by using an Applied Biosystems High-Capacity cDNA Reverse transcription Kit (Invitrogen, MA, USA) according to the manufacturer's instructions. RT-PCR was performed using a QuantiTect SYBR Green PCR kit (Qiagen, Valencia, USA) and Corbett Research Rotor-Gene RG-3000 Real Time PCR System. Pre-designed primers for human GATA4, Nkx2.5, cTnI, Runx2, PPAR-γ, Col2a1, Nanog, Sox2, Oct4, Fog2, Art27, YAP, p21, and AREG were purchased from Bioneer (Daejeon, Korea). MiR-130a was quantified by RT-PCR using TaqMan® MicroRNA Reverse Transcription Kit (Life Technologies, USA). The primers of miR-130a and 18S were purchased from TaqMan® MicroRNA assay (Life Technologies, USA).
+ Open protocol
+ Expand
5

Synthetic siRNA Targeting Key Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic small interfering RNAs (siRNAs) specific for GFP, EGFR, ATG7, NANOG, TRPV1, and CaMKKβ were purchased from Bioneer (Daejeon, KOR). The sequence were: non-specific GFP (green fluorescent protein), 5′-GCAUCAAGGUGAACUUCAA-3′ (sense), 5′-UUGAAGUUCACCUUGAUGC-3′ (antisense); EGFR #1, 5′-GAUCCACAGGAACUGGAUA-3′ (sense), 5′-UAUCCAGUUCCUGUGGAUC-3′ (antisense); EGFR #2, 5′-UUAGAUAAGACUGCUAAGGCAUAGG-3′ (sense), 5′-CCUAUGCCUUAGCAGUCUUAUCUAA-3′ (antisense); ATG7 #1, 5′-CAGCUAUUGGAACACUGUA-3′ (sense), 5′-UACAGUGUUCCAAUAGCUG-3′ (antisense); ATG7 #2, 5′-CAGCUAUUGGAACACUGUA-3′ (sense), 5′-UACAGUGUUCCAAUAGCUG-3′ (antisense); NANOG #1, 5′-GCAACCAGACCUGGAACAA-3′ (sense), 5′-UUGUUCCAGGUCUGGUUGC-3′ (antisense); NANOG #2, 5′-CUAAACUACUCCAUGAACA-3′ (sense), 5′-UGUUCAUGGAGUAGUUUAG-3′ (antisense); TRPV1 #1, 5′-GGAGACCUGUCUGCUGAAAUU-3′ (sense), 5′-AAUUUCAGCAGACAGGUCUUC-3′ (antisense); TRPV1 #2, 5′-GGAGUUCACCGAGAACUAU-3′ (sense), 5′-AUAGUUCUCGGUGAACUCC-3′ (antisense); CaMKKβ #1, 5′-GUGAAGACCAUGAUACGUA-3′ (sense), 5′-UACGUAUCAUGGUCUUCAC-3′ (antisense); and CaMKKβ #2, 5′-GACCAUCUGUACAUGGUGU-3′, and 5′-ACACCAUGUACAGAUGGUC-3′ (antisense). For in vitro delivery, the cells were transfected with 100 pmol of synthesized siRNAs using Lipofectamine 2000 (Invitrogen, San Jose, CA, USA, 11668027) according to the manufacturer’s instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!