Rabbit anti mecp2 antibody

Cell proteins were extracted by using RIPA buffer. Protein concentration was measured with the BCA method. Approximately 30 μg of protein from each sample was loaded on 8% SDS-PAGE gels and run at 80V constant voltage. A constant current of 300 mA was used for transblotting. Blots were probed with rabbit anti-MeCP2 antibodies (1:1,000, Abcam) and anti-SIRT1 antibodies (1:2,000, Abcam) overnight at 4°C. After washing three times, blots were then incubated with goat anti-rabbit secondary antibody (1:1,000) at room temperature for 2 h. Then, chemiluminescence was used to visualize protein bands. The housekeeping gene β-actin (anti-β-actin antibody, 1:1000, Abcam) was used as internal control. The protein abundance of MeCP2 and SIRT1 was calculated based on the comparative gray value to β-actin.

Cell proteins were extracted by RIPA. The protein concentration was measured with the BCA method. Approximately 30 μg of protein from each sample was loaded on 8% SDS–PAGE gels and run at 80 V constant voltage. A constant current of 300 mA was used for transblotting. Blots were probed with rabbit anti-MeCP2 antibodies (1:1000; Abcam) and anti-SIRT1 antibodies (1:2000; Abcam) overnight at 4 °C. After washing three times, blots were then incubated with goat anti-rabbit secondary antibody (1:1000) at room temperature for 2 h. Chemiluminescence was then used to visualize protein bands. The housekeeping gene anti-β-actin antibody (1:1000; Abcam) was used as control.

ChIP assay was performed using the Imprint Chromatin Immunoprecipitation Kit (Sigma‐Aldrich) according to the manufacturer's instructions. Chromatin from the RPE cells was first fixed with 1% formaldehyde for 10 minutes, and cells were fragmented using the Branson Sonifier (Branson). The RPE lysate was incubated with Protein A agarose (Sigma‐Aldrich) at 4°C for 45 minutes for pre‐clearing. The DNA‐protein complexes were then immunoprecipitated with rabbit anti‐MeCP2 antibody (Abcam) overnight at 4°C. DNA fragments were eluted by using DNA release solution and reversing solution provided by the kit. The resultant DNA including RPE samples and input was analysed by quantitative polymerase chain reaction (qPCR) and the TGF‐β2 primer sequences as follows: 5′‐CGGGAGACTTGATTGTCCTT‐3′ (sense) and 5′‐TTTGTTCCTGGATGACTCCC‐3′(anti‐sense). The PCRs were run using ZymoTaq Premix (Zymo Research, Irvine, CA) in the MyCycler Thermocycler (Bio‐Rad). The running conditions were 10 minutes at 95°C, followed by 35 cycles of 30 seconds at 95°C, 30 seconds at 56°C 1 and min at 72°C. PCR products were separated by electrophoresis on a 1.5% agarose gel.