Rnaiso for small rna kit

Expression level of miR-421 in cell lines was calculated by quantitative real-time PCR (qRT-PCR). Small RNA was extracted from cell lines with RNAiso Kit for Small RNA (TaKaRa, Japan) and subsequently reverse transcribed into cDNA with One Step PrimeScript miRNA cDNA Synthesis Kit (TaKaRa, Japan). Total RNA was extracted from cell lines with RNAiso plus (TaKaRa, Japan) and transcribed into cDNA using PrimeScript RT reagent Kit (TaKaRa, Japan). cDNAs were quantified by SYBR Premix Ex Taq (TaKaRa, Japan) by ABI 7500 fast real-time PCR System (Applied Biosystems, Carlsbad, USA). Small nuclear RNA U6 and GAPDH mRNA were used as internal controls for normalization. All primers were listed in Supplementary Table S1.

MircoRNAs were extracted from cultured cell lines with the RNAiso kit for small RNA (Takara, China) and reversely transcribed into cDNA with the One Step PrimeScript miRNA cDNA Synthesis Kit (Takara, China). Total RNA was isolated with TRIzol reagent (Takara, China) and reversely transcribed into cDNAs with the PrimeScript RT reagent Kit (Takara, China). The resulting cDNAs were quantified with SYBR Green reagent (Takara, China) by using the ABI 7500 fast real-time PCR System (Applied Biosystems, USA). The relative expression levels of miRNAs (miR-608) and mRNAs (FLOT1, CDK4 and CCND1) normalized by small nuclear RNA U6 and GAPDH mRNA respectively were calculated with the 2^-ΔΔCt method. All the qPCR primers were provided by Sango Biotech (Shanghai, China). All primers used are listed in Table 1.

Total RNA was extracted using an RNA extraction kit (Invitrogen, China) and digested with DNase I (Takara, China) according to the manufacturers’ instructions. The RNA quality and integrity were analysed by agarose gel electrophoresis and the RNA concentration was determined using a biophotometer (METASH, B–500, China). cDNA was synthesized from total RNA using AMV Reverse Transcriptase (Promega, China). Small RNA was extracted using an RNAiso kit for small RNA (Takara, China) and digested with DNase I (Takara, China) according to the product manuals. Reverse transcription was performed with a cDNA Synthesis Kit (Promega, China) in combination with a stem-loop RT-PCR technique73 (link). Quantitative RT-PCR was performed on a 7500 RT-qPCR system (Applied Biosystems, USA) with SYBR Green Real-time PCR Master Mix (Toyobo, China) according to the manufacturer’s instructions. Gene expression was normalized to that of rice ACTIN1. Primers used for qRT-PCR are presented in Supplemental Table S1.

Total RNA were isolated from the five taproot samples (10, 15, 20, 40 and 50 DAS, respectively) using Trizol reagent (Invitrogen, USA) and then treated with PrimeScript® RT reagent Kit (Takara, Dalian, China) to reverse transcribe into cDNA. MicroRNA was extracted from five radish taproot samples using RNAiso for small RNA kit (Takara, Dalian, China) and reverse transcribed into cDNA using a One Step PrimeScript® miRNA cDNA Synthesis Kit (Takara, Dalian, China). The cDNA was quantified by an iCycler IQ real-time PCR detection system (BIO-RAD) using a 20 μl reaction mixture, which consisted of 2 μl of diluted cDNA, 0.2 μM forward and reverse primer, and 10 μl of 2× SYBR Green PCR Master Mix (Takara, Dalian, China). The amplification reaction for miRNAs and their targets was performed, respectively, according to the previous reports [24 (link),25 (link),31 (link)]. The equation ratio 2^−ΔΔCτ was applied to calculate the relative expression level of miRNAs and targets using 5.8S rRNA and Actin gene as the reference gene, respectively. The primers for real-time RT-qPCR were designed using Beacon Designer 7.0 software (Additional file 1A and B). In addition, the statistical analysis with SAS Version 9.0 software (SAS Institute, Cary, North Carolina, USA) was performed using Duncan’s multiple range test at the P < 0.05 level of significance.

RNAs for CMC treatment were total enriched small RNA including mitochondrial and cytosolic tRNAs, isolated from various cell lines by using RNAiso for Small RNA kit (TaKaRa). Twenty micrograms of RNAs were incubated with 160 mM 1-cyclohexyl-(2-morpholinoethyl) carbodiimide metho-p-toluene sulfonate (CMCT) for 20 min at 37°C to allow for carbodiimide (CMC) modification of Ψ residues (34 (link)). The reaction mixtures contain 7 M urea, 4 mM EDTA, 50 mM Bicine, pH 8.5. The modified RNAs were then precipitated by adding 2 μl of Pellet Paint Co-Precipitant, 50 μl of 3 M sodium acetate, pH 5.5, and triple volume of ethanol, incubated at least 2 h at –20°C before centrifuging at 12 000 rpm for 30 min. The RNA pellets were dissolved in 1 M sodium carbonate, pH 10.4, incubated for 4 hours at 37°C, and precipitated again as described above. Primescript II 1st Strand cDNA Synthesis Kit (TaKaRa) was used for reverse transcription with digoxigenin (DIG)-labeled oligodeoxynucleotide probes specific for 22 mitochondrial tRNAs and 4 cytosolic tRNAs (Supplemental Table S1). RNase A was added to the extension reaction to remove the mitochondrial RNA. The DNA was then precipitated with ethanol at –20°C overnight after phenol extraction. Two micrograms of DNA samples were applied onto 15% polyacrylamide, 7 M urea electrophoresis gel and electroblotted onto a positively charged nylon membrane.

To isolate single tRNA^Ala, tRNA^Val, tRNA^Glu, tRNA^Leu, and tRNA^Gly, small RNA (< 200 nt) was extracted using RNAiso for Small RNA Kit (Takara, catalog number: 9753A) according to the manufacturer’s instruction. One milligram of small RNAs was then incubated overnight at 50°C with Biotin-labeled oligonucleotides probes (5′-tRNA^Ala: 5′-Bio-CGCTCTACCACTGAGCTACACCCCC; 5′-tRNA^Val: 5′-Bio-GTGATAACCACTACACTACGGAAAC; 5′-tRNA^Glu: 5′-Bio-ATCCTAACCGCTAGACCATGTGGA; 5′-tRNA^Gly: 5′-Bio-AATTCTACCACTGAACCACCCATGC; 5′-tRNA^Leu: 5′-Bio-) CCTTAGACCGCTCGGCCATCCTGAC) in the 1 × SSC buffer. Following overnight incubation, the RNA solution was incubated for 30 min at room temperature with streptomycin affinity agarose beads (Cytiva, catalog number: 17511301) which were washed three times using 400 μl 20 uM Tris-HCl (PH = 7.5) in ULTARAFREE MC GV STER tube (Millipore, catalog number: UFC30GV0S) in advance. The mixture was centrifuged at 2500 g for 30 s and the centrifugal liquid was collected as a negative control, followed by a wash with 0.5 × SSC. Finally, targeted tRNAs were washed from the beads with RNase-free water and extracted using ethyl alcohol. Isolated individual tRNA was confirmed by the northern blot. Original uncropped images of the northern blot and denatured gel are shown in Additional file 7: Fig. S7.

A total of 8 DEmiRNAs were chosen for verification with the aim of verifying the outcomes of high-throughput sequencing. The primer information for quantitative real-time PCR (qRT-PCR) is shown in Table S1. Total RNA extraction was carried out using spleen samples used to construct miRNA libraries. MiRNA was isolated from total RNA using an RNAiso for Small RNA Kit (Takara, Beijing, China) and reverse-transcribed into first-strand cDNA using the Mir-X™ (Vazyme, Nanjing, China). Then, the fluorescence quantification of reverse-transcribed cDNA was performed in an ABI 7500 real-time PCR system (ABI, Los Angeles, CA, USA) using TaKaRa Taq HS Perfect Mix reagent (TaKaRa, Osaka, Japan), with U6 as an endogenous reference.