After extraction of total RNA from cell lines and 8 pairs clinical tissue samples, reverse transcription and PCR were performed using cDNA synthesis kits (TransGen, China) and SYBR real-time PCR kits (TransGen, China), respectively, under the manufacturer’s instructions, and quantitative analysis was performed based on the 2−ΔΔCt method. The primer sequences of the target genes are detailed in the Table. S1 .
Cdna synthesis kit
Manufactured by Transgene
Sourced in China, United States
The cDNA Synthesis Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. This process is a fundamental step in various genetic and molecular biology applications, such as gene expression analysis, reverse transcription PCR, and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (31 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (7 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
Sybr green, by Transgene (4 mentions)
Lightcycler 480 2, by Roche (4 mentions)
Lightcycler 480 system, by Roche (3 mentions)
Transscript one step gdna removal kit, by Transgene (3 mentions)
Rnaprep pure micro kit, by Aidlab (3 mentions)
Icycler iq real time pcr system, by Bio-Rad (3 mentions)
Sybr green master mix, by Bio-Rad (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Transzol up, by Transgene (2 mentions)
Cfx connect, by Transgene (2 mentions)
Sybr green supermix, by Transgene (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Sybr green qpcr kit, by Transgene (2 mentions)
Abi q3, by Thermo Fisher Scientific (2 mentions)
Easypure rna kit, by Transgene (2 mentions)
Transstart top green qpcr supermix, by Transgene (2 mentions)
Transstart tip green qpcr supermix kit, by Transgene (2 mentions)
98 protocols using cdna synthesis kit
1
Quantitative Gene Expression Analysis
2
Quantitative PCR of EOC Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from EOC specimens and cells were isolated using TRIzol solution (AndeBio, Xuhui, Shanghai, China). Subsequently, 1 μg total RNA was reverse transcribed into cDNA using cDNA Synthesis kits (Transgen, Shijingshan, Beijing, China). Then, qPCR was conducted using a SYBR–Green Master Mix kit (TIANGEN, Haidian, Beijing, China) and performed by CFX96 qPCR machine (Invitrogen, Carlsbad, CA, U.S.A.). The housekeeping gene, GAPDH, was used as internal control. The primers are listed in Table 1 . The 2−ΔΔCt method was used to calculate the relative fold changes.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, total RNA was extracted from cell lysates or cytoplasm and nuclear extracts using TransZol Up (Transgen, Beijing, China). RNA was analyzed quantitatively using a NanoDrop (NanoDrop Technologies, Rockland, DE, USA). Total RNA (1 μg) was reverse transcribed into cDNA using a cDNA synthesis kit (Transgen, Beijing, China) according to the manufacturer’s instructions. RT-PCR was performed in a Bio-Rad CFX connect real-time system detector with Transgen SYBR Green Supermix. The reactions were analyzed using Bio-Rad CFX Maestro software (Version 4.1). The threshold cycles (CTs) were calculated, and the relative gene expression was analyzed after normalizing to GAPDH. Experimental-related primers were designed and produced by Takara (Maebashi, Japan). The primers were as follows:
4
Quantifying TGFA Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EasyPure RNA kit (product code ER101‐01; TransGen) was used to extract total RNA from stably transfected cells, and first‐strand cDNA was generated using a cDNA synthesis kit (product code AT311‐02; TransGen) according to the manufacturer's instructions. Real‐time PCR was used to evaluate TGFA transcription levels using the SYBR Green qPCR kit (product code AQ132; TransGen) with GAPDH as the internal reference gene. The following primers were used: TGFA gene, 5′‐GATTCCCACACTCAGTTCTGC‐3′ for forward and 5′‐GAAGATGGTGATGGGATTTC‐3′ for reverse; GAPDH gene, 5′‐GAAGGTGAAGGTCGGAGTC‐3′ for forward and 5′‐GAAGATGGTGATGGGATTTC‐3′ for reverse. An ABI‐Q3 was used to conduct PCR at 94°C for 30 s, followed by 45 cycles of amplification at 94°C for 5 s, 51°C for 15 s and 72°C for 10 s (Thermo Fisher Scientific, Inc.). The mRNA expression level was quantified by 2−ΔΔCt.
29 (link)
29 (link)
5
Quantitative PCR Analysis of Mouse Renal Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using a Trizol reagent (Life Technologies, Gaithersburg, MD, USA), total RNA was isolated from mouse renal tissues. Afterwards, 2 μg of RNA was used to carry out reverse transcription, employing a cDNA synthesis kit (TransGen Biotech, Beijing, China). The cDNA was subsequently diluted 10 times before being used to conduct quantitative PCR in accordance with the suggested procedure in the QuantStudio Real-Time PCR detection biosystem (Thermo Fisher Scientific, Carlsbad, CA, USA) with a qPCR Mix (AG11718, Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China). β-actin was used as a reference gene to determine the target gene expression. Table 2 contains a list of all mouse primer sequences (Sangon Biotech Co., Shanghai, China) utilized in the present study.
6
Gene Expression Analysis of EECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EECs were pretreated with hUCMSC-CM or serum-free MDEM/F12 in 6 cm plates for 48 h. The cells were collected, and the total RNA was extracted by an RNA isolation kit (Vazyme, Nanjing, Jiangsu Province, China), followed by a reverse transcription using a cDNA synthesis kit (TransGen Biotech, Beijing, China). The cDNA was followed by a real-time quantitative polymerase chain reaction (PCR) using the KAPA SYBR® FAST Master Mix (KAPA BIO, Boston, MA, USA) with a primer. Each gene expression level was normalized, with GAPDH used as a housekeeping control. The primer sequences were as follows: Wnt5a, forward 5′-CTCGCCATGAAGAAGTCCA-3′ and reverse 5′- TACCTAGCGACCACCAAGAA -3′; cyclin D1, forward 5′- GCTGCGAAGTGGAAACCATC -3′ and reverse 5′- CCTCCTTCTGCACACATTTGAA -3′; c-myc, forward 5′- GTCAAGAGGCGAACACACAAC -3′ and reverse 5′- TTGGACGGACAGGATGTATGC -3′; CTNNB1, 5′- GGTGGGCTGCAGAAAATGGTT -3′ and reverse 5′- GATGGCAGGCTCAGTGATGTCTTC -3′.
7
Quantitative PCR Analysis of microRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNAiso Plus reagent (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. Total RNA (1 µg) was reverse-transcribed using a cDNA Synthesis kit (Beijing Transgen Biotech Co., Ltd., Beijing, China), and the resulting cDNA was used as the template for qPCR. qPCR was performed in a BIO-RAD IQ5 Real-Time PCR system with a PCR SYBR Green Master mix reagent kit (Beijing Transgen Biotech Co., Ltd.). Following an initial denaturing for 2 min at 94°C, qPCR was performed with 45 cycles of 94°C for 20 sec and 60°C for 34 sec. All reactions were performed in triplicate. The results were analyzed using the Cq method, using Data Assist Software version 3.0 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The human β-actin gene was used as an endogenous control. The sequences of the PCR primers used are provided in Table I . The universal primer used for miR-21, miR-199a-3p and U6 was obtained from the miRcute Plus miRNA qPCR Detection kit (SYBR-Green) (cat. no. FP411; Tiangen Biotech Co., Ltd.). Data were analyzed with a one-way analysis of variance and Tukey's test using Microsoft Excel 2010 (Microsoft Corporation, Redmond, WA, USA). P<0.05 was considered to indicate a statistically significant difference.
8
Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted in Trizol (Life Technologies, Massachusetts, USA). 2 μg of total RNA was reverse transcribed to generate cDNA, using cDNA synthesis kit (TransGene, Beijing, China). Real-time qPCR analysis was performed in triplicates, with GAPDH as internal controls, using SYBR Green qPCR SuperMix and the StepOnePlus (Applied Bio-systems, California, USA) Real-Time Detection System and following the manufacturer’s instructions. The PCR primers were designed using Primer 3, and their specificity was verified using BLAST (NCBI, Maryland, USA). Primers used in this study are as follows: RLIM-f, TGAGAGATAACAATTTGCTAGGC and RLIM-r, GTGGGCCTTCTTTAATTTGC; p21-f, TGTCCGCGAGGATGCGTGTTC and p21-r, GCAGCCCGCCATTAGCGCAT; p15-f, AGATCCCAACGCCCTGAAC and p15-r, CCCATCATCATGACCTGGATT; GAPDH-f, GAGTCAACGGATTTGGTCGT and GAPDH-r, GACAAGCTTCCCGTTCTCAG.
9
RNA Isolation and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the transfected cell lines was isolated using the TRIzol reagent (Invitrogen, Waltham, MA, USA), and reverse transcribed to cDNA using a cDNA Synthesis Kit (TransGen Biotech, Beijing, People’s Republic of China). Real-time PCR was performed using the qPCR SuperMix (Takara Co, Minamikusatsu, Japan) and StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using a standardized protocol. Calculation of target RNA levels was based on the CT method and normalized to β-actin expression. All reactions were run in triplicate over multiple days. Information about primer sequences is summarized and presented in Table 1 .
10
Real-time qPCR Analysis of T. salsuginea
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed from previously reported cDNAs or genes from RNA-Seq data of T. salsuginea. We designed gene-specific primers using PRIMER 5.0 software (Table S6 ). RT-PCR was used to confirm primers quality and PCR amplification efficiency. We used 1 µg total RNA to synthesize first-strand cDNA using the cDNA Synthesis Kit (TransGen Biotech, Beijing, China). Real-time PCR was performed using TransStart® Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) on the Bio-rad system (Hercules, CA, USA). The amplification procedures were as follows: 95 °C for 1 min, followed by 40 cycles at 95 °C for 30 s, 58 °C for 30 s. All samples were assayed in triplicate wells. Data acquisition and analysis were performed for each run using ICYCLERIQ software (version 3.0a Bio-Rad, Hercules, CA, USA). To normalize the differences in the total RNA amount, UBQ5 was used as an internal control [69 (link)]. The 2−△△Ct method was used to calculate the relative expression change [70 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!