Immunocult xf t cell expansion medium

The CAR transgene from a pSFG.iCasp9.2A.14G2A-CD28-OX40-CD3ζ retroviral CAR plasmid (gift from Dr. Malcom Brenner, Baylor College of Medicine, Houston, TX, USA) was used to generate virus-free CRISPR anti-GD2 CAR T cells as previously described [19 (link)]. Primary human T cells were isolated from peripheral blood mononuclear cells from healthy donors using an Institutional Review Board-approved protocol from the University of Wisconsin-Madison (#2018-0103, Madison, WI, USA). The anti-GD2 CAR T cells were cultured in ImmunoCult-XF T cell Expansion Medium (Stemcell™ Technologies, Vancouver, BC, Canada) supplemented with 500 U/mL of IL-2 (Peprotech, Cranbury, NJ, USA) and maintained 37 °C in 5% CO₂.

T cell killing assay was performed as previously described (34 (link)). Human primary T cells (70024, STEMCELL Technologies) were maintained in RPMI-1640 with 10% FBS and 10 ng/mL of IL-2 (589102, BioLegend). For T cell expansion and activation, T cells were cultured in ImmunoCult-XF T Cell Expansion Medium (10981, STEMCELL Technologies) with 25 μL/mL of ImmunoCult Human CD3/CD28 T Cell Activator (10971, STEMCELL Technologies) and 10 ng/mL of IL-2 for 7 days. To analyze the killing effect of T cells, 3 × 10⁵ of tumor cells were cocultured with 3 × 10⁶ of activated T cells in DMEM with 10% FBS, 25 μL/mL of T cell activator and 10 ng/mL of IL-2 for 48 hours. Then LDH release assay was performed.

Activated MDDCs were treated with 50 µg/mL Mitomycin C (Sigma), washed 3 times with media and resuspended in ImmunoCult™-XF T Cell Expansion Medium (Stemcell Technologies). Human Peripheral Blood Pan-T Cells from an independent donor (Stemcell Technologies) were labeled with CellTrace™ Violet (CTV) Cell Proliferation dye (ThermoFisher Scientific) according to the manufacturer’s instructions. MDDCs (1.5×10⁴ cells/well) were co-incubated with CTV-labeled pan-T cells (1.5×10⁵) at a 1:10 ratio in the absence and presence of O₂-cryogels for 6 days. Additionally, CTV-labeled T cells were stimulated with anti-CD3/anti-CD28 Dynabeads (aCD3/aCD28) (ThermoFisher Scientific) and cell stimulation cocktail of phorbol 12-myristate 13-acetate (PMA) and ionomycin (PMA-ionomycin) (ThermoFisher Scientific) as positive controls for activation and proliferation. Then, cells were stained for viability, cell surface lineage and activation markers for T cells such as CD3, CD4, CD8, and CD25 as previously described. Allogenic T-cell proliferation was assessed by tracking CTV dilution among CD3+ T-cell population. Supernatants were collected and secretion of Th1 cytokines such as IFN-γ, IL-2, TNF-α and TNF-β were analyzed using Cytokine & Chemokine 34-Plex Human ProcartaPlex™ Panel 1A (ThermoFisher Scientific) and FLEXMAP 3D® System (Luminex).

To measure CAR expression dynamics by western blot analysis, CAR T cells were incubated with NALM6 tumor cells at a ratio of 1:2 CAR T cell:NALM6 cells, in ImmunoCult-XF T Cell Expansion Medium (StemCell) and 50 U/mL IL-2. Cells were collected at the indicated time points and processed for western blot analysis as described above. The total protein expression level of the anti-CD19 CAR was detected with an anti-CD3z antibody (Santa Cruz Biotechnology).

Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), Iscove's modified Dulbecco's medium (IMDM), Roswell Park Memorial Institute (RPMI) 1640, Dynabeads CD3/CD28, and Human interleukin‐2 (IL‐2) Recombinant Protein (Invitrogen) were purchased from Thermo Fisher Scientific. HeLa, K562, and Jurkat (human acute T cell leukemia cell line) cells were purchased from American Tissue Culture Collection (ATCC; Manassas, VA). ImmunoCult‐XF T Cell Expansion Medium was purchased from STEMCELL Technologies. FITC‐dextran molecules were purchased from MilliporeSigma. pcDNA3.1+C‐eGFP plasmid and plasmid encoding Cas9 and sgRNA were purchased from GenScript. For PTEN targeted gene knockout experiment, the 20bp sgRNA sequence of TTATCCAAACATTATTGCTA was used. YOYO‐1 dye (1 mm solution in DMSO; Invitrogen, cat. no. Y3601), DAPI (4′,6‐diamidino‐2‐phenylindole) stain, CellMask Deep Red Plasma membrane Stain, PTEN Monoclonal Antibody, and Goat anti‐Mouse IgG (H+L) Highly Cross‐Adsorbed Secondary Antibody, Alexa Fluor Plus 647 were purchased from Thermo Fisher Scientific.

CD8⁺ T-cells were purified (> 95%) from a cell suspension harvested from non-adherent peripheral blood mononuclear cells (PBMCs), using a CD8a⁺ T Cell Isolation Kit (130–045-201, Miltenyi Biotec, Bergisch Gladbach, Germany) according to the manufacturer’s instructions. CD8⁺ T cells were cultured in the ImmunoCult™-XF T Cell Expansion Medium (10,981, STEMCELL Technologies Inc., Vancouver, Canada) with ImmunoCult™ Human CD3/CD28/CD2 T Cell Activator (10,970, STEMCELL Technologies Inc.). DCs were resuspended in serum-free AIM-V medium (Gibco) and were stimulated with 50 μg/ml peptide twice with an interval of 24 h, treated with 30 ug/mL mitomycin C (A4452, APExBIO, Houston, TX, USA) for 30 min and washed. CD8⁺ T cells were stimulated with the above-described DCs at a ratio of 20: 1 on day 1 and day 6 to generate epitope/DC-CTL.