Purelink rna micro kit

Total RNA was isolated with the PureLink® RNA Micro Kit (Thermo Fisher scientific, Italy) for in vitro experiments and with PureLink® RNA Mini Kit (Thermo Fisher scientific, Italy) for tissue, according to the manufacturer's recommendations. Reverse transcription into cDNA was performed with the Superscript III Reverse Transcriptase kit (Invitrogen, Thermo Fisher scientific, Italy) according to the manufacturer's protocol and then amplified by real-time PCR using iQ SYBR Green Supermix (Bio-Rad Laboratories, Milan, Italy). PCR was performed by using the primers described in the Supplementary Table 2. RNA expression was calculated relative to the housekeeping beta-actin gene expression on the base of the ΔCt algorithm.

Total RNA was extracted from three technical replicate muscle tissues or neuromuscular co-culture for each of 3 biological replicate experiments using the PureLink RNA Micro Kit according to the manufacturer’s protocol (ThermoFisher). cDNA was reverse transcribed from 400 ng of RNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). For quantitative real-time PCR (qRT-PCR), CHRNE and CHRNG primers were acquired from Bio-Rad and reactions were run according to manufacturer’s protocol on the Roche LightCycler 480 (Roche) using LightCycler 480 SYBR Green I Master (Roche). All results were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Gene expression is reported in % of GAPDH expression ±SEM. To assess agrin gene expression in differentiated MNs, cDNA samples were prepared from three consecutive MN differentiations. Genes were amplified using Arktik thermal cycler according to the manufacturer’s protocol (ThermoFisher). PCR amplification products were analyzed on a 2% agarose gel with SYBR safe DNA gel stain (Invitrogen). GAPDH gene expression served as the loading control. All oligo sequences are summarized in Table 4.

Mouse femora or molars were homogenized in TRIzol reagent (Thermo Fisher Scientific) using Tissue Lyser (Qiagen, Hilden, Germany), and total RNA was purified using the PureLink RNA Micro kit (Thermo Fisher Scientific). Quantitative Real-Time PCR was performed by using the One Step SYBR Prime Script PLUS RT-PCR (TAKARA, Shiga, Japan) using StepOnePlus or 7500 Fast systems (Thermo Fisher Scientific). Gene expression data were normalized to Gapdh or Col1a1 expression. The primers for each gene are shown in Table 1.Table 1

Primers used for Real-time PCR.

Gene	Forward (5′–3′)	Reverse (5′–3′)
Csf-1	GAACAGCCTGTCCCATCCATC	TGAGGCCAGCTCAGTGCAA
Rankl	CATGTGCCACTGAGAACCTTGAA	CAGGTCCCAGCGCAATGTAAC
Opg	CATGAGGTTCCTGCACAGCTTC	ACAGCCCAGTGACCATTCCTAGTTA
F4/80	GAGATTGTGGAAGCATCCGAGAC	GACTGTACCCACATGGCTGATGA
Csf-1r	GGCCCAGCCTGTATTTGCAC	ACCGCTGCTTGGCAGGTTAG
Col1a1	TCAGTGCAATTGTGTTGCTGAAAG	GATACCAAACTGGGCGTGCTG
Gapdh	TGTGTCCGTCGTGGATCTGA	TTGCTGTTGAAGTCGCAGGAG

Total RNAs from cultured cells and tissues were isolated using the PureLink RNA Micro Kit (Thermo Fisher Scientific) and PureLink RNA Mini Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. The total RNAs were reverse transcribed with Superscript III (Life Technologies). Real-time PCR was performed with SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan) using CFX96 real-time PCR detection system (Bio-Rad Laboratories, CA, USA) as described previously^{15 (link)}. The expression levels of Pogz (forward primer sequence: 5′-CCCTACCTATGTGCATTGTTCTC-3′; reverse primer sequence: 5′-TCCGTGGAACATGATTGTTG-3′) were normalized to those of Gapdh and were determined according to the 2^−∆∆Ct method.

Total RNA was isolated from FACS-enriched tdT+ cells of DIV20 using Trizol LS reagent (Thermo Fisher Scientific, 10296010) and the PureLink RNA Micro Kit (Thermo Fisher Scientific, 12183016) as per manufacturer’s instructions. Complementary DNA (cDNA) was generated by reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814). RT-qPCR was performed with the synthesized cDNA using Taqman fast universal 2X PCR Master Mix (Thermo Fisher Scientific, 4352042) and Taqman probes (Thermo Fisher Scientific) on a 7500 Fast Real-Time PCR system (Applied Biosystems). The Taqman probes used in this study are the following: Actb (Mm02619580_g1), Acta2 (Mm00725412_s1), Foxd3 (Mm02384867_s1), Ngfr (Mm00446296_m1), Sox10 (Mm00569909_m1), S100b (Mm00485897_m1). C_t values obtained were normalized to β-actin and relative changes in expression were calculated using ΔΔC_t analysis.

The analysis of exosomal miRNAs was performed by HiSeq2500 (Illumina, San Diego, CA, USA) and at least 5 million reads per sample were obtained. Library preparation and sequencing was done by ZAO Genoanalytica as follows: miRNA was extracted from exosomes by PureLink RNA Micro Kit (12183-016 (Thermo Fisher Scientific, Waltham, MA, USA)) according to the manual. Library preparation was carried out with the NEBNext Small RNA Library Prep Set for Illumina (E7330S (New England Biolabs, Hitchin, UK)). The associations between miRNAs and ESR1 were searched by using the integrative database of human miRNA target predictions mirDIP [103 (link)], which aggregates the data from all known miRNA databases. The likelihood level was specified as medium. All studied miRNAs were found as potentially targeting ESR1. Some of them (miR-181a-2-3p and hsa-miR-874-3p) were found to be within 1% of top miRNAs annotated with ESR1 (very high confidence class). Moreover, these 6 miRNAs were selected concerning the literature indicated in Table 1. All hyperexpressed miRNAs are provided in Table S1 in the supporting file.

Total RNA was extracted from cells and tissue using the RNeasy Mini (Qiagen) or Purelink RNA Micro Kit (Thermofisher, Waltham, MA, USA), and complementary DNA was synthesized using M-MLV reverse transcriptase (Thermofisher) with oligo(dT). A gene expression assay was conducted using SYBR Green methods on Viia7 (Applied Biosystems, Waltham, MA, USA), and relative cycle threshold (CT) values were normalized by ACTB (β-actin). The following primers were used to detect expression: (mCd36: Fwd 5′-GATGGCCTTGCTTGGGATTGGA-3′, Rev 5′-GGCTTTACCAAAGATGTAGCCAGTG-3′; mFabp4: Fwd 5′-AAGTGGGAGTGGGCTTTGC-3′, Rev 5′-GGCTTTACCAAAGATGTAGCCAGTG-3′; mPparg: Fwd 5′-TGGGGATGTCTCACAATGCC-3′, Rev 5′-GATCTCCGCCAACAGCTTCT-3′; mSrebp1: Fwd 5′-GAACAGACACTGGCCGAGAT-3′, Rev 5′-TGAGCTGGAGCATGTCTTCG-3′; hCD36: Fwd 5′-AGTGATGATGAACAGCAGCAACA-3′, Rev 5′-CCTCAGCGTCCTGGGTTACAT-3′; hFABP4: Fwd 5′-AGGAATTTGACGAAGTCACTGCA-3′, Rev 5′-TGATTTTCCATCCCATTTCTGC-3′; hPPARG: Fwd 5′-ATGCTGGCCTCCTTGATGAA-3′, Rev 5′-TCACCAAAAGGCTTTCGCAG-3′; and hSREBP1: Fwd 5′-GCGGACAACCCATAATATCATTG-3′, Rev 5′-GCATCTTGGCGTCTGTCCC-3′).