Stepone thermocycler

RNA was extracted using TRIzol reagent (Invitrogen Life Technologies, Grand Island, NY). One microgram of total RNA was used to generate cDNA (Advantage RT-for-PCR Kit; Clontech, Palo Alto, CA). Real-time PCR was carried out on a StepOne Thermocycler (Applied Biosystems, Foster City, CA) using Applied Biosystems TaqMan® Gene Expression Master Mix (Applied Biosystems, Foster City, CA.) according to the manufacturer’s protocol. The expression assay was carried out using the following TaqMan probes: Hs00153153_m1 for HIF-1α, Hs01026149_m1 for HIF-2α (EPAS1), Hs00541709_m1 for HIF-3α, Hs00426835_g1 for ACTA2 (αSMA) all of the above labeled with FAM and normalized with Hs99999901_s1 for 18S ribosomal RNA labeled with VIC (Applied Biosystems, Foster City, CA). Relative quantitation method was used to analyze the results of two independent experiments made in triplicate. For each experimental sample, a gene was considered as not expressed if amplification was not detected by threshold cycle Ct = 40.

Total RNA was isolated from an 8-well pool using a EuroGold Trifast™ kit solution (Euro-clone, Milan, Italy) according to the manufacturer’s instructions and reverse-transcribed to generate complementary DNA (cDNA) using oligo-dT primers (Bioneer; Daejeon, Korea); purity (260/280 nm ratio) and concentration (at 260 nm) were assessed using a BioSpectrometer® (Eppendorf AG, Hamburg, Germany). RNA samples were treated with DNAse (Merck), and 1 µg/20 µL was reverse-transcribed using HiScript® III RT SuperMix (Vazyme Biotech Co.; Nanjing, China). RT was performed using a StepOne™ thermocycler (Applied Biosystems, StepOne™ software v.2.3) according to the manufacturer’s instructions under the following thermal conditions: 2 min at 45 °C, 15 min at 37 °C, followed by 5 s at 85 °C. The cDNA samples were stored at − 20 °C.

The quantification of the mRNA levels of the housekeeping genes GAPDH and β-ACTIN, pluripotency genes OCT4 and NANOG, GC markers FRAGILIS, PIWIL2 and STELLA, SSC markers UCHL1 and CD90 and male GC markers DAZL and STRA8, was determined using Q-PCR (Table 1). Total RNA was isolated from cells using a Quick-RNA MiniPrep kit (Zymo Research) following the manufacturer’s instructions. Total RNA was quantified using a Qubit 3.0 (Invitrogen, Fluorometer, CA, USA). Genomic DNA digestion was performed using DNase I from the Quick-RNA MiniPrep kit (Zymo Research) following the manufacturer’s instructions. The cDNA was synthesized and amplified using an Affinity Script Q-PCR cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), using a Step One thermocycler (Applied Biosystems, Foster City, CA, USA). The PCR reaction was performed using a Brilliant SYBR Green QPCR Master Mix kit (Agilent Technologies) and an Eco Real-Time PCR System thermocycler (Illumina, San Diego, CA, USA). Each reaction tube consists of 5 μL Sybr Green, 1 μL forward primer, 1 μL reverse primer, 2 μL nuclease-free H₂O and 5 ng cDNA. The cDNA amplification was extended for 40 cycles, and relative expression analysis was performed using the ΔΔCt (Ct: threshold value) method normalized with both GAPDH and β-ACTIN housekeeping genes [30 (link)].

Treated and untreated cells were washed with phosphate-buffered saline (PBS) and centrifuged. Cell pellets were resuspended in 0.8 ml of TRI Reagent™ (#AM9738, Invitrogen), vortexed and incubated for 5–10 min at RT. Then, samples were added with 0.16 ml of chloroform (Fisher Scientific), vortexed, incubated for 5 min at RT and centrifuged at 4°C for 15 min at 20 000 × g. The upper phase was collected and nucleic acids were isopropanol precipitated. Samples were digested with DNase I, phenol extracted and then RNA was ethanol precipitated. RNA quality was checked with agarose gels, and 1 μg of RNA was used to prepare cDNA with SuperScript III (Invitrogen) according to manufacturer’s instructions using random (N6) and poly(T) primers. After primer annealing, retrotranscription reaction was performed for 50 min at 50°C. Then, RNA was alkaline hydrolyzed and ethanol precipitated. Quantitative PCR (RT-qPCR) was performed using 500 nM of specific primers in SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) with Applied Biosystems StepOne thermocycler. Quantification and analyses were performed using StepOne Software v2.2.3. Specificity of PCR products was routinely checked with melting curves and agarose gel electrophoresis. PCR primers are reported in Supplementary Table S2.

Total RNA was isolated by RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions, RNA was treated with DNase (Promega, Milan, Italy) to exclude DNA contamination and 1 μg total RNA reverse-transcribed using VILO SuperScript (Invitrogen, Monza, Italy). Gene expression assays were performed on a StepOne Thermocycler (Applied Biosystems, Monza, Italy) and the amplifications carried out using SYBR Green PCR Master Mix (Applied Biosystems, Monza, Italy). The reaction conditions were as follows: 95 °C for 15 min, followed by 40 cycles of three steps consisting of denaturation at 94 °C for 15 s, primer annealing at 60 °C for 30 s, and primer extension at 72 °C for 30 s. A melting curve analysis was performed from 70 °C to 95 °C in 0.3 °C intervals. Each sample was performed in triplicate. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize for differences in RNA input. Primers sequences are reported in Table 1.Table 1

Sequences of primers used.

Gclc	Forward Primer	GGAAGTGGATGTGGACACCAGA
	Reverse Primer	GCTTGTAGTCAGGATGGTTTGCG
Nqo2	Forward Primer	GTATGCCATGAACCTTGAGCCG
	Reverse Primer	GCTCATCAGTGATGTCGCTAGC
Ho-1	Forward Primer	CCAGGCAGAGAATGCTGAGTTC
	Reverse Primer	AAGACTGGGCTCTCCTTGTTGC
GAPDH	Forward Primer	GTCTCCTCTGACTTCAACAGCG
	Reverse Primer	ACCACCCTGTTGCTGTAGCCAA

RNA from cells and tissue was collected using on-column RNA isolation and purification (Omega Bio-tek), and cDNA generated with a high-capacity cDNA reverse transcriptase kit (Applied Biosystems, 4368814). Quantitative analysis of expression was performed using TaqMan assays [Hprt (Mm03024075_m1), Tnf (Mm00443258_m1), Il1b (Mm00434228_m1), Ifng (Mm01168134_m1), Cxcl1 (Mm04207460_m1), Il4 (Mm00445259), Il6 (Mm00446190_m1), Il10 (Mm01288386_m1), Il12 (Mm00434169_m1), Arg1 (Mm00475988_m1), and Nrg4 (Mm00446254_m1)] on an Applied Biosystems StepOne Thermocycler. Fold change was calculated using the 2^−ΔΔCt method (20 (link)). Results are expressed as average fold change in gene expression relative to control or nontreatment group using HPRT as the reference gene.