Taqman primer probe set

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

TaqMan primer/probe sets are molecular biology reagents used in quantitative real-time PCR (qPCR) assays. They consist of a forward primer, a reverse primer, and a fluorescent probe designed to specifically target and detect a DNA sequence of interest. The probe is labeled with a reporter dye and a quencher dye, which allows for the detection and quantification of the target DNA during the PCR amplification process.

Automatically generated - may contain errors

Lab products found in correlation

123 protocols using taqman primer probe set

Quantifying Fusobacteria and PGT in Colon Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols


Reagent	Manufacturer	Catalog #	Comments
Frozen human colon tumor samples and matched normal samples	^#iSpecimen		Data include age, gender, ethnicity, diagnosis, histopathology report
Gentra Puregene Genomic DNA extraction kit	Qiagen	158667	Replaces Qiagen 69504
PicoGreen Assay	^#Life Technologies	P7589
Spectrophotometer	^#NanoDrop	ND1000
384-well optical PCR plate	^#Phoenix Research	MPS-3898
Fusobacteria forward qPCR primer	Part of a custom-designed Taqman primer/probe set (Applied Biosystems)		CAACCATTACTTTAACTCTA CCATGTTCA
Fusobacteria reverse qPCR primer			GTTGACTTTACAGAAGGAGA TTATGTAAAAATC
Fusobacteria FAM probe			TCAGCAACTTGTCCTTCTTGA TCTTTAAATGAACC^†
PGT forward qPCR primer	Part of a custom-designed Taqman primer/probe set (Applied Biosystems)		ATCCCCAAAGCACCTGGTTT
PGT reverse qPCR primer			AGAGGCCAAGATAGTCCTG GTAA
PGT FAM probe			CCATCCATGTCCTCATCTC
TaqMan Universal Master Mix	ABI	^#4304437
qPCR thermal cycling system	ABI	^#4351405	7900HT system

^†Note: Probe sequence from original manuscript incorrect. Correct sequence seen here from Flanagan et al., 2014 (link).

Repass J., Maherali N, & Owen K. (2016). Registered report: Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. eLife, 5, e10012.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue preparation, RNA extraction, RT–PCR, and quantitative real-time PCR analyses were performed as described [13 (link)]. The following TaqMan primer/probe sets (Applied Biosystems, Madrid, Spain) were used for quantitative RT– PCR: BDH1 (Mm00558330_m1); BDH2 (Mm00459075_m1); HMGCS2 (Mm00550050_m1); CD36 (Mm01135202_g1); PPARα (Mm00440939_m1); CPT1α (Mm01231183_m1); PEPCK (Mm00440636_m1); PCX (Mm00500992_m1); FBP1 (Mm00490181_m1); FGF21 (Mm00840165_g1); and 18S ribosomal (18S) (Mm03928990_g1). 18S was used as a housekeeping gene.

López-Soldado I., Bertini A., Adrover A., Duran J, & Guinovart J.J. (2020). Maintenance of liver glycogen during long-term fasting preserves energy state in mice. FEBS letters, 594(11), 1698-1710.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissue or cells, using an E.Z.N.A.® Total RNA Kit (OMEGA). cDNAs were synthesized using qScript cDNA SuperMix (QuantaBio). Quantitative real-time PCR Taqman primer probe sets (Applied Biosystems) were used, and the relative gene expression was determined on an ABI 7900HT quantitative PCR machine (ABI Biosystems) using Taqman Gene Expression Master Mix (Applied Biosystems). The comparative threshold cycle method was used to calculate fold changes in gene expression, which were normalized to the expression of HPRT, GAPDH, and/or TBP as reference genes.

Jiang H., Liu X., Knolhoff B.L., Hegde S., Lee K.B., Jiang H., Fields R.C., Pachter J.A., Lim K.H, & DeNardo D.G. (2019). The development of resistance to FAK inhibition in pancreatic cancer is linked to stromal depletion. Gut, 69(1), 122-132.

+ Open protocol

+ Expand

Quantifying Interferon Response Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and DNase-treated using RNeasy micro kit (Qiagen, Venlo, Netherlands). cDNA was generated using High Capacity kit (Applied Biosystems, Waltham, MA, USA). qPCR was performed using MyIQ machine (BioRad, Hercules, CA, USA) and Taqman primer/probe sets recognizing IFN-γ and interferon response genes IRF7 and ISG15 (Applied Biosystems). Expression levels are shown relative to expression of GAPDH and β-actin (Applied Biosystems).

Hansen L., Schmidt-Christensen A., Gupta S., Fransén-Pettersson N., Hannibal T.D., Reizis B., Santamaria P, & Holmberg D. (2015). E2-2 Dependent Plasmacytoid Dendritic Cells Control Autoimmune Diabetes. PLoS ONE, 10(12), e0144090.

+ Open protocol

+ Expand

Quantifying Zebrafish Pigmentation Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

TaqMan primer/probe sets designed to amplify and detect zebrafish pigr, pigrl1.4, pigrl2.3, pigrl3.10 and pigrl4.2 transcripts were purchased from Applied Biosystems. Reverse transcription was completed as described above. Quantitative PCRs were executed on a MyiQ Real time PCR detection system with IQ5 Optical system software (Bio-Rad). Reactions were completed in triplicate and average relative transcript levels calculated by normalizing to transcript levels of the eukaryotic translation elongation factor 1 alpha 1, like 1 (eef1a1l1) gene by the ΔΔCt method (Livak and Schmittgen 2001 (link)).

Kortum A.N., Rodriguez-Nunez I., Yang J., Shim J., Runft D., O’Driscoll M.L., Haire R.N., Cannon J.P., Turner P.M., Litman R.T., Kim C.H., Neely M.N., Litman G.W, & Yoder J.A. (2014). Differential expression and ligand binding indicate alternative functions for zebrafish polymeric immunoglobulin receptor (pIgR) and a family of pIgR-like (PIGRL) proteins. Immunogenetics, 66(4), 267-279.

+ Open protocol

+ Expand

Rhesus Macaque RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissues using TRIzol (Ambion by Life Technologies) as per the manufacturer’s protocol. RNA (1 μg) was treated with DNase I, RNase-free (ThermoScientific) as per the manufacturer’s protocol. miRNA-specific cDNA was generated using miRNA stem-loop-specific primers (miS1 and U6) and the High Capacity cDNA Reverse Transcription Kit (Life Technologies). Samples were run on the Bio-Rad CFX384 Real Time System C1000 Touch using Bio-Rad CFX Manager v.3.1 software. Exogenous miS1 was quantified by designed primer/probes to be used with TaqMan Master Mix (Applied Biosystems). Endogenous Rhesus U6 was used to normalize expression across samples; primer/probes for miS1 and U6 were ordered from Integrated DNA Technologies. In addition, complementary DNA libraries were also generated. Endogenous mRNA of ATXN1 (Hs00165656_m1), GFAP (Rh00909240_m1) and IBA1(AIF1) (Rh00894882_m1) and transgene expression of ATXN1L (Hs04964302_s1) were quantified by (Rh02621745_g1) commercial TaqMan primer/probe sets (Applied Biosystems). Endogenous Rhesus GAPDH was used to normalize expression across samples.

Keiser M.S., Ranum P.T., Yrigollen C.M., Carrell E.M., Smith G.R., Muehlmatt A.L., Chen Y.H., Stein J.M., Wolf R.L., Radaelli E., Lucas TJ I.I., Gonzalez-Alegre P, & Davidson B.L. (2021). Toxicity after AAV delivery of RNAi expression constructs into nonhuman primate brain. Nature medicine, 27(11), 1982-1989.

+ Open protocol

+ Expand

SNP Genotyping in CR2 Gene

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eight single nucleotide polymorphism (SNP) sites in the CR2 gene were selected based on locations, potential relevance to disease, and published data [11 (link), 16 (link), 17 (link)]. The genotype was determined using a TaqMan fluorogenic 5′-nuclease assay with predesigned or custom TaqMan primer/probe sets (Applied Biosystems, Foster City, CA). For genotyping of polymorphic sites, amplification primers and probes were designed for TaqMan assays (Applied Biosystems, Foster City, CA). The primer and probe sequences are indicated in Table 1. We designed both the PCR primers and the minor groove binder (MGB) TaqMan probes using Primer Express (Applied Biosystems). All reactions were performed following the manufacturer's protocol. Details regarding the PCR reaction and TaqMan assay have been described previously [9 (link)]. The fluorescence data files from each plate were collected and analyzed using automated allele-calling software (SDS 2.2, Applied Biosystems).

Kim T.H., Bae S.C., Lee S.H., Kim S.Y, & Baek S.H. (2016). Association of Complement Receptor 2 Gene Polymorphisms with Susceptibility to Osteonecrosis of the Femoral Head in Systemic Lupus Erythematosus. BioMed Research International, 2016, 9208035.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Gene Expression

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR (TaqMan®; Applied Biosystems; Foster City, CA, USA) was performed using specific primers and probes (Supplementary Table 3)^{33 (link),47 (link)–49 (link),54 (link)}. Values were expressed in relation to hypoxanthine-guanine phosphoribosyl-transferase (Hprt) levels. For the analysis of the human WAT samples, we used commercially available and pre-validated TaqMan® primer/probe sets (Applied Biosystems; Carlsbad, CA, USA) as follows: endogenous control peptidylprolyl isomerase A (cyclophilin A) (PPIA, 4333763) and UCP1^{38 (link)}. Gene expression values were expressed relative to PPIA levels.

Seoane-Collazo P., Liñares-Pose L., Rial-Pensado E., Romero-Picó A., Moreno-Navarrete J.M., Martínez-Sánchez N., Garrido-Gil P., Iglesias-Rey R., Morgan D.A., Tomasini N., Malone S.A., Senra A., Folgueira C., Medina-Gomez G., Sobrino T., Labandeira-García J.L., Nogueiras R., Domingos A.I., Fernández-Real J.M., Rahmouni K., Diéguez C, & López M. (2019). Central nicotine induces browning through hypothalamic κ opioid receptor. Nature Communications, 10, 4037.

+ Open protocol

+ Expand

Real-Time PCR Protocol for Gene Expression Analysis

Cited 6 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed real-time PCR (TaqMan; Applied Biosystems) as previously described (Lopez et al. 2010 (link), Martinez de Morentin et al. 2012 (link), 2014 (link), Whittle et al. 2012 (link), Contreras et al. 2014 (link), Alvarez-Crespo et al. 2016 (link), Martins et al. 2016 (link)), using specific sets of primers and probes for rat (Supplementary Table 1, see section on supplementary data given at the end of this article). Values were expressed relative to hypoxanthine–guanine phosphoribosyltransferase (HPRT) levels. For the analysis of the human WAT samples, we used commercially available and pre-validated TaqMan primer/probe sets (Applied Biosystems) as follows: endogenous control peptidylprolyl isomerase A (cyclophilin A) (PPIA, 4333763), PR domain containing 16 (PRDM16, Hs00223161_m1), uncoupling protein 1 (UCP1, Hs00222453_m1) and cell death-inducing DFFA-like effector a (CIDEA, Hs00154455_m1). Gene expression values were expressed relative to PPIA levels.

Martínez-Sánchez N., Moreno-Navarrete J.M., Contreras C., Rial-Pensado E., Fernø J., Nogueiras R., Diéguez C., Fernández-Real J.M, & López M. (2016). Thyroid hormones induce browning of white fat. The Journal of Endocrinology, 232(2), 351-362.

+ Open protocol

+ Expand

Isolation and Analysis of Murine Immune Cell RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

We isolated total RNA from murine AMø, PMø, BMDM and microglia using the RiboPure Kit (Ambion; Grand Island, NY) and removed DNA contamination using the TURBO DNA-free kit (Ambion). cDNA was prepared from total RNA using the RETROscript kit (Ambion). For microRNA amplification, specific cDNA was prepared from total RNA using the TaqMan MicroRNA Reverse Transcription kit. All reagents and kits were used according to the manufacturer’s instructions. We performed RT-PCR using TaqMan Gene Expression Master Mix with TaqMan primer-probe sets from Applied Biosystems (Carlsbad, CA) for RNU6B (001093), sno142 (001231), miR-34a (000426), GAPDH (4352932E), SIRT1 (Mm00490758_m1).

McCubbrey A.L., Nelson J.D., Stolberg V.R., Blakely P.K., McCloskey L., Janssen W.J., Freeman C.M, & Curtis J.L. (2015). miR-34a negatively regulates efferocytosis by tissue macrophages in part via SIRT1. Journal of immunology (Baltimore, Md. : 1950), 196(3), 1366-1375.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!