Abi prism 7300 sequence detector

Total RNA was extracted from EndoC-βH2 cells by using the RNeasy Micro kit (Qiagen, Hilden, Germany). First-strand cDNA was prepared by employing the Maxima First Strand cDNA synthesis kit (Thermo Fisher, Waltham, MA, USA). Real-time PCR was performed using Power SYBR Green mix (Applied Biosystems, Foster City, CA, USA) with ABI Prism 7300 sequence detector (Applied Biosystems). Cyclophilin A transcript levels were used for the normalization of each target gene. The custom primers were designed with IDT Primer-Quest online software, and the amplification efficiency for each primer was determined with serial dilution of total cDNA from EndoC-βH2 cells (4 (link)).

Total RNA was isolated from the correspondent mice or human tissue using Trizol reagent (Sigma-Aldrich). The RNA was treated with DNase at 37 °C for 30 min and reverse-transcribed into cDNA using SuperScript^® III Reverse Transcriptase (Invitrogen, Waltham, MA, USA).
Quantitative real-time PCR was performed to quantified gene expression. Assays were done using Power SYBR Green PCR Master Mix (Applied Biosystems, Walthman, MA, USA) and the corresponding specific primers: Serpin3n (Fw: 5′GGGATGATCAAGGAACTGGTCT3′, Rev: 5′CCGCGTAGAACTCAGACTTGAA3′), Clxcl10 (Fw: 5′CCAAGTGCTGCCGTCATTTTC3′, Rev: 5′GGCTCGCAGGGATGATTTCAA3′), Adora2A (Fw: 5′GCCATCCCATTCGCCATCA3′, Rev: 5′GCAATAGCCAAGAGGCTGAAGA3′), murine CD4 (Fw: 5′AGGTGATGGGACCCTACCTCTC3′, Rev: 5′GGGGCCACCACTTGAACTAC3′), Tgfα (Fw: 5′CACTCTGGGTACGTGGGTG3′, Rev: 5′CACAGGTGATAATGAGGACAGC3′, human CD4 (Fw: 5′CAAGGAGGCAAAGGTCTCGAA3′, Rev: 5′CGGCACCTGACACAGAAGA3′) andthe internal control 36B4 (Fw: 5′AACATCTCCCCCTTCTCCTT3′, Rev: 5′GAAGGCCTTGACCTTTTCAG3′). Real-time was carried out using an ABI Prism 7300 sequence detector (Applied Biosystems, Walthman, MA, USA) and data were analyzed using the Sequence Detection software v.3.0 (Applied Biosystems). Relative gene expression was calculated in reference to the control group using the DDCT method.