Allele id 6

Manufactured by Premier Biosoft

Sourced in United States

Allele ID 6 is a software application designed for primer and probe design. It provides functionality for identifying optimal primer and probe sequences for various molecular biology applications, including PCR and qPCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

13 protocols using allele id 6

Quantification of RAGE and GLO1 Expressions

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RAGE, GLO1, and β-actin genes primers were designed using Allele ID 6 software (PREMIER Biosoft International 3786 Corina Way Palo Alto CA 94303-4504, USA). The primer blast software was applied in order to check the primer accuracy that were bind to the target position, and not to link it to other locations. 22 placebo group samples and 23 vitamin D group samples were examined in the mRNA expression analysis using qPCR, and also three replicates per sample have been tested along with that.
In addition, β-actin gene was utilized as housekeeping. The primers sequence is presented in Table 1. For gene expression, real-time PCR was performed using the Step One system (Applied Biosystems, Foster City, CA, USA), real-time PCR system and SYBR Green detection method [17 (link)]. In the following, all gene expression data were normalized to β-actin (ΔCT). The fold changes were calculated by the use of the 2^−ΔΔCT method.Table 1

Primers used for this study

Gene name	Sequence
RAGE	Forward: 5′-GCAGTCGGAGCTAATGGTG-3′
RAGE	Reverse: 5′-AGGTCAGGGTTACGGTTCCA-3′
GLO-1	Forward: 5′-CAGACCATGCTACGAGTGA-3′
GLO-1	Reverse: 5′-GGTCTCATCATCTTCAGTGC-3′
β-actin	Forward: 5′-TGGCACCCAGCACAATGAAG -3′
β-actin	Reverse: 5′-AGTCATAGTCCGCCTAGAAGC-3′

Omidian M., Djalali M., Javanbakht M.H., Eshraghian M.R., Abshirini M., Omidian P., Alvandi E, & Mahmoudi M. (2019). Effects of vitamin D supplementation on advanced glycation end products signaling pathway in T2DM patients: a randomized, placebo-controlled, double blind clinical trial. Diabetology & Metabolic Syndrome, 11, 86.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The quantitative real‐time PCR (qRT‐PCR) reaction was performed in 96‐well plates using 2.0X RealQ‐PCR Master Mix^® with SYBR Green (Ampliqon) on ABI StepOnePlus™ Real‐Time PCR Detection System (Applied Biosystems). All qRT‐PCR primers were designed by Allele ID 6 software (Premier Biosoft) and described in Table 1. Each reaction mixture consisted of 1 µL cDNA (10 ng), 10 µL 2X RealQ‐PCR Master Mix^®, 1 µL (10 pmol/µL) of both forward and reverse primers, and 7 µL of PCR‐grade water, equating to a final volume of 20 µL. The beta‐2 microglobulin (β2M) mRNA was used as the reference gene. β2M was selected as the reference gene according to previous research for identification of housekeeping control genes in colorectal cancer.¹⁹ The thermal profile of the reaction was performed using the following conditions: initial denaturation at 95°C for 15 minutes; followed by 40 cycles at 95°C for 15 seconds and 60°C for 60 seconds followed by melting curve stage assessment. The melting curve profile and agarose gel electrophoresis were performed to verify the specificity of primers and the authenticity of the PCR products.

Sadeghi H., Kamaliyan Z., Mohseni R., Sahebi U., Nazemalhosseini‐Mojarad E., Aghaei N., Zali M.R., Asadzadeh Aghdaei H., Mirfakhraie R, & Moshiri A. (2020). Dysregulation of vitamin D synthesis pathway genes in colorectal cancer: A case‐control study. Journal of Clinical Laboratory Analysis, 35(2), e23617.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of the VG and CA were separately extracted. cDNA was synthesized from 1 μg RNA using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China). All specific primers for qPCR were designed by AlleleID 6 software (PREMIER Biosoft, Palo Alto, CA, United States). The qPCR was run in the CFX96^TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States) using ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) according to the manufacturer’s protocol. The programs were set as follows: enzyme activation at 95°C for 30 s, followed by 40 cycles with denaturation at 95°C for 5 s, annealing and extension at 60°C for 30 s, and a melting curve analysis. mRNA expression levels were normalized to the reference (28S rRNA) (Ballinger and Perlman, 2017 (link)), and quantified based on the comparative 2^–ΔΔCT method (Livak and Schmittgen, 2001 (link)). The experiments were repeated 3 times.

Yang L., Yang Y., Liu M.M., Yan Z.C., Qiu L.M., Fang Q., Wang F., Werren J.H, & Ye G.Y. (2020). Identification and Comparative Analysis of Venom Proteins in a Pupal Ectoparasitoid, Pachycrepoideus vindemmiae. Frontiers in Physiology, 11, 9.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR was performed using the CFX96™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with the ChamQ SYBR qPCR Master Mix Kit (Vazyme, Nanjing, China). The specific qPCR primers were designed by AlleleID 6 software (PREMIER Biosoft, Palo Alto, CA, USA), and actin was used as the reference gene (Table S1). qPCR program was set as 3 min at 95 °C and 40 cycles for 15 s at 95 °C and 30 s at 60 °C. Each measurement was repeated thrice. Gene expression levels between the two groups were calculated based on the comparative 2^-ΔΔCt method [33 (link)]. The expression fold changes of DEGs were visualized using GraphPad Prism 7.0 software (GraphPad, San Diego, CA, USA), and data were analyzed by unpaired two-tailed Student’s t-Test. Pearson’s correlation method was used to evaluate the association between RNA-seq and qPCR. In brief, log₂ Fold change(qPCR) values were plotted against the log₂ Fold change(FPKM) values. All statistical significances were tested using Data Processing System (DPS) package version 9.50 and marked with different asterisks (*: p < 0.05, **: p < 0.01, ***: p < 0.001) [34 (link)].

Gulinuer A., Xing B, & Yang L. (2023). Host Transcriptome Analysis of Spodoptera frugiperda Larvae Parasitized by Microplitis manilae. Insects, 14(2), 100.

+ Open protocol

+ Expand

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by Trizol reagent (Invitrogen, USA). The cDNA synthesis kit (ThermoFisher Scientific, USA) was used following the manufacturer’s instruction. The relative mRNA expression data was analyzed using the 2^−ΔΔCt method with GAPDH RNA used as a reference gene. Primers were designed by AlleleID6 software (PREMIER Biosoft International, USA). Gene sequences of MMP-9 and GAPDH were obtained from GenBank (NCBI, BethesdaMD, USA) (NM_004994.3 and NM_002046.5), and BLAST analysis (NCBI) was performed on the primer pair to evaluate their specificity.

Dehghani S., Kooshafar Z., Almasirad A., Tahmasvand R., Moayer F., Muhammadnejad A., Shafiee S, & Salimi M. (2019). A novel hydrazide compound exerts anti-metastatic effect against breast cancer. Biological Research, 52, 40.

+ Open protocol

+ Expand

Quantitative Reverse Transcription PCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The first-strand complementary DNA (cDNA) was synthesized from total RNA using PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Beijing, China). qPCR was carried out using the ChamQ^TM SYBR^® qPCR Master Mix (Vazyme, Nanjing, China) and run on a CFX96™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) following the manufacturer’s instructions. The specific qPCR primers were designed using AlleleID 6 software (PREMIER Biosoft, Palo Alto, CA, USA) (Supplementary Materials, Figure S1), gene expression levels were normalized to the reference gene (28S rRNA) [35 (link)]. The qPCR programs were set as following: enzyme activation at 95 °C for 30 s, followed by 40 cycles with denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and melting curve analysis. The mRNA expression levels were determined by the comparative 2⁻^△△CT method [36 (link)].

Yang L., Wang B., Qiu L., Wan B., Yang Y., Liu M., Wang F., Fang Q., Stanley D.W, & Ye G. (2019). Functional Characterization of a Venom Protein Calreticulin in the Ectoparasitoid Pachycrepoideus vindemiae. Insects, 11(1), 29.

+ Open protocol

+ Expand

Quantitative Analysis of CCNB2 in Metastatic Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

PBMC samples of the patients, histologically diagnosed as metastatic and non-metastatic
BCs (24 cases of BC), were subjected to quantitative reverse-transcription polymerase
chain reaction (qRT-PCR) analysis by Rotor-Gene Q (Qiagen, Germany) to determine
CCNB2 mRNA levels. Clinicopathological characteristics of the patients
were obtained from their medical records. All samples were collected with informed consent
from patients and the current study protocol was established by the Human Ethics Research
Committee of Shahid Beheshti University of Iran (IR.SBMU.RETECH.REC.1398.688). For
qRT-PCR, following the extraction of RNA using Trizol (Invitrogen, USA), RNA was
reverse-transcribed by the Superscript First-Strand Synthesis System (ThermoFisher
Scientific, USA). Primers for CCNB2 and GAPDH, as a
housekeeping gene, were designed by AlleleID6 software (PREMIER Biosoft International,
USA) and checked against the GenBank database to ensure that no similarities remained with
other known human DNA sequences (Table S1, See Supplementary Online Information at
www.celljournal.org). The ΔΔCt method was used to calculate the comparative gene
expression levels.

Moradpoor R., Zali H., Gharebaghian A., Akbari M.E., Ajdari S, & Salimi M. (2021). Identification of CCNB2 as A Potential Non-Invasive Breast Cancer Biomarker in Peripheral Blood Mononuclear Cells Using The Systems Biology Approach. Cell Journal (Yakhteh), 23(4), 406-413.

+ Open protocol

+ Expand

Quantitative Analysis of Ovarian Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The adipose tissue surrounding the right ovary and uterus was separated and homogenized in the RNA Lysis buffer. Then, after extracting total RNA and synthesizing cDNA(Yekta Tajhiz, Iran), the primers of the target genes and a housekeeping gene (GAPDH) were designed using Allele ID 6 software (Premier Bio soft, USA) and aligned on BLAST website (Table 1). Real-time PCRs were run using SYBR Green Master mix according to the protocols (Yekta Tajhiz, Iran) on a LightCycler® 96 thermal cycler Instrument (Roche Diagnostics, Switzerland). Amplification specificity was checked using a melting curve assay.

Table 1

PCR Primer Sequences

Target	Amplicon(bp)	Primers	Sequences, 5’→ 3’
GAPDH	224	F	CGGTGTGAACGGATTTGG
GAPDH	224	R	CTCGCTCCTGGAAGATGG
TNF-α	201	F	CCTCTTCTCATTCCTGCTTGTG
TNF-α	201	R	ACTTGGTGGTTTGCTACGAC
TGF-β	193	F	AATTCCTGGCGTTACCTTGG
TGF-β	193	R	GGCTGATCCCGTTGATTTCC
COX-2	248	F	GCACTACATCCTGACCCACTTC
COX-2	248	R	GCTCCTTATTTCCCTTCACACC
MMP-9	249	F	GGCGTGTCTGGAGATTCG
MMP-9	249	R	GCAGGAGGTCGTAGGTCAC

GAPDH: glyceraldehyde-3-phosphate dehydrogenase; TNF-α: Tumor necrosis factor-alpha; TGF-β: transforming growth factor-β; COX-2: Cyclooxyganase-2; MMP-9: Matrix metallopeptidase-9; F: Forward; R: Reverse.

Shamsi M., Ganji A., Mosayebi G., Amirhoseiny E.S., Shohani S, & Ghazavi A. (2023). Chamomile and Urtica dioica extracts improve immunological and histological alterations associated with polycystic ovarian syndrome in DHEA -induced mice. BMC Complementary Medicine and Therapies, 23, 102.

+ Open protocol

+ Expand

qRT-PCR Analysis of CYP24A1 in Colorectal Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qRT-PCR analysis was performed on an ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA) using 2.0X RealQ-PCR Master Mix® with SYBR Green (Ampliqon, Odense, Denmark). The primer sets for CYP24A1 and Beta-2-microglobulin (β2M) genes were designed by Allele ID 6 software (Premier Biosoft, Palo Alto, USA) (Table 1). Each reaction consisted of 10 µl 2X RealQ-PCR Master Mix®, 1 µl cDNA (10 ng), 1 µl of each primer (10 pmol) and 7 µl of nuclease-free water to conduct PCR in a 20 µl of reaction mixture. We carried out the reactions in duplicate and β2M gene was used as normalization control. This gene was selected according to previous research for identi cation of housekeeping control genes in colorectal cancer [16] . Two-step thermal cycling and real-time data acquisition were performed using the following conditions: 95 °C for 15 min × 1 cycle, and 95 °C for 15 s, followed by 60 °C for 1 min × 40 cycles followed by melt curve stage assessment. The melting curve pro le and agarose gel electrophoresis were performed to verify the speci city of primers and the authenticity of the PCR products.

Sadeghi H., & Heiat M. (2020). Potential diagnostic value of novel circular RNA hsa_circ_0060927 in human colorectal cancer.

+ Open protocol

+ Expand

Stem-loop qPCR assay for miRNA-377 detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequence of the miRNA-377 was retrieved from the miRBase at http://www.mirbase.org/. In order to increase the exibility of stem-loop structure as well as achieving necessary sensitivity, the published sequence of Chen et al. was modi ed [20] . The modi cations included addition of fourteen nucleotides to the original sequence in order to lengthen the loop and enabling the design of a universal reverse primer inside it and substitutions for decreasing the melting temperature of the stem part. This new designed structure was able to speci cally detect each miRNA because few nucleotides complimentary to the 3'UTR of miRNA were added to each stem-loop [21] . Almost complete sequence of miRNA-377 was used as the forward primer for real-time PCR assay. miRNA forward primer and the mRNA real-time PCR primers were designed with Allel ID, Gene Runner software programs and Primer blast (Table 4) were designed by Allele ID6 software (PREMIER Biosoft, USA). Secondary structure analysis of the amplicon was performed with ''mfold'' software (http://mfold.rna.albany.edu/?q=mfold/). All Oligos were purchased from Metabion international AG (Lena-Christ-Strasse, Germany).

Hashemi S., Yari N., Rahimi Jamnani F., Mahdian R., Karimi M., Zeinali S., Rafiee M.H, & Azizi M. (2022). The role of miRNA-377 as a tumor suppressor in lung cancer by negative regulation of genes belonging to ErbB signaling pathway. Molecular biology reports, 49(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!