When cultured En-PSCs reached 70–80% confluency, negative control small interfering ribonucleic acid (si-NC, 50 nM, RiboBiO, Guangzhou, China), CYR61-specific small interfering ribonucleic acid (si-CYR61, 50 nM, RiboBiO), vector control (GV141, 5 μg/106 cells, GENE CHEM, ShangHai, China), or CYR61 overexpression plasmids (GV141-CYR61, 5 μg/106 cells, GENE CHEM) were transfected into En-PSCs (passage 6) using the Lipofectamine® 3000 transfection reagent (L3000075, Invitrogen). En-PSCs were taken as a control group. The transfection efficiency among five groups, including control group, si-NC group, si-CYR61 group, vector group, and ov-CYR61 group, was detected after 48 h by western blotting and ELISA.
Gv141
Manufactured by Genechem
Sourced in China
The GV141 is a precision laboratory instrument designed for conducting chemical and biological analyses. It features advanced optics and sensitive detection capabilities to enable accurate and reliable measurements. The core function of the GV141 is to provide researchers and scientists with a versatile tool for their analytical needs.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Gv141 cyr61, by Genechem (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Si nc, by RiboBio (1 mentions)
Bamhi, by New England Biolabs (1 mentions)
Xhoi, by New England Biolabs (1 mentions)
Blasticidin, by Thermo Fisher Scientific (1 mentions)
Gv298, by Genechem (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
7 protocols using gv141
1
Regulation of Endometrial Stem Cells
2
Stable WIF-1 Expression in GBC-SD Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A vector containing WIF-1 and an empty vector (GV141) were purchased from Shanghai Genechem Co., Ltd. (Shanghai, China). Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used as the transfection reagent. The GBC-SD cells were diluted to 1,000 cells/ml and incubated at 37°C and 5% CO2 in 24-well plates. G418 (Invitrogen; Thermo Fisher Scientific, Inc.) was used for selection. Following 1 week of G418 selection, cell line stably expressing WIF-1 (WGBC-SD) and expressing the empty plasmid (NGBC-SD) were produced, and these cells were expanded for further experiments.
3
Cloning and Mutagenesis of FLNB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full length of the major transcript of human FLNB was synthesized and cloned into the transient overexpression vector GV141 (GeneChem, China), using the restriction enzymes XhoI and BamHI (NEB, USA). c.4846A>G and c.7022T>G mutation sites were generated by site-directed mutagenesis (GeneChem, China). The detailed protocol used for site-directed mutagenesis is available upon request. The entire coding sequences of all the constructs were verified using sequencing.
4
Establishing GLUT4-Overexpressing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Flag‐tagged GLUT4 in eukaryotic expression vector GV141 was purchased from Genechem (Shanghai, China). BGC823 cells were transfected with GLUT4 plasmids or control plasmids followed by 1 μg/mL purine (Gibco) screening for 2 weeks to obtain stable GLUT4‐overexpressing or control cells. Lentiviral constructs pLenti6 were purchased from Invitrogen (Carlsbad, CA, USA). shRNA constructs were constructed by cloning shRNA fragments into pLenti‐U6 (Invitrogen) and GV298 (Genechem). The sequences of shRNAs for ISL1 and GLUT4 knockdown are listed in Supplementary Table S1 .
Stable cell lines were established with a lentiviral vector using previously described protocols [32 ]. Briefly, lentiviruses were used to infect the cells for 2 days. Stable clones were selected by treating the cells with 3 μg/mL blasticidin (Gibco) for 2 weeks.
Stable cell lines were established with a lentiviral vector using previously described protocols [
5
Knockdown and Overexpression of G9A and CASP1 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
G9A siRNAs were synthesized by Ribobio Inc. (Guangzhou, China). Transfections were performed with Lipofectamine 2000 (11668019; Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Total RNA or cell lysates were prepared 48 h after transfection and were used for real-time RT-PCR or western blotting (WB).
Sequences for siRNAs targeting G9A were as follows: #1: 5′-CCAUGCUGUCAACUACCAUdTdT-3′ (sense) and 5′-AUGGUAGUUGACAGCAUGGdTdT-3′ (antisense); and #2: 5′-GAACAUCGAUCGCAACAUCdTdT-3′ (sense) and 5′-GAUGUUGCGAUCGAUGUUCdTdT-3′ (antisense); and #3: 5′-GCUAUGAGGCUACUGAGUAdTdT-3′ (sense) and 5′-UACUCAGUAGCCUCAUAGCdTdT-3′ (antisense).
CASP1 siRNAs were synthesized by GenePharma Inc. (Shanghai, China). The sequences for siRNAs targeting CASP1 were as follows: #1: 5′-GGUGUGGUUUAAAGAUUCATT-3′ (sense) and 5′-UGAAUCUUUAAACCACACCTT-3′ (antisense); #2: 5′-GAAGACUCAUUGAACAUAUTT-3′ (sense) and 5′-AUAUGUUCAAUGAGUCUUCTT-3′ (antisense); and #3: 5′-CUCUCAAGGAGUACUUUCUTT-3′ (sense) and 5′-AGAAAGUACUCCUUGAGAGTT-3′ (antisense).
G9A and CASP1 overexpression plasmids and the control plasmid (GV141) were purchased from GeneChem Inc. (Shanghai, China). Plasmids were transfected into cells using Lipofectamine 2000 (11668019; Invitrogen) according to the manufacturer's protocol.
Sequences for siRNAs targeting G9A were as follows: #1: 5′-CCAUGCUGUCAACUACCAUdTdT-3′ (sense) and 5′-AUGGUAGUUGACAGCAUGGdTdT-3′ (antisense); and #2: 5′-GAACAUCGAUCGCAACAUCdTdT-3′ (sense) and 5′-GAUGUUGCGAUCGAUGUUCdTdT-3′ (antisense); and #3: 5′-GCUAUGAGGCUACUGAGUAdTdT-3′ (sense) and 5′-UACUCAGUAGCCUCAUAGCdTdT-3′ (antisense).
CASP1 siRNAs were synthesized by GenePharma Inc. (Shanghai, China). The sequences for siRNAs targeting CASP1 were as follows: #1: 5′-GGUGUGGUUUAAAGAUUCATT-3′ (sense) and 5′-UGAAUCUUUAAACCACACCTT-3′ (antisense); #2: 5′-GAAGACUCAUUGAACAUAUTT-3′ (sense) and 5′-AUAUGUUCAAUGAGUCUUCTT-3′ (antisense); and #3: 5′-CUCUCAAGGAGUACUUUCUTT-3′ (sense) and 5′-AGAAAGUACUCCUUGAGAGTT-3′ (antisense).
G9A and CASP1 overexpression plasmids and the control plasmid (GV141) were purchased from GeneChem Inc. (Shanghai, China). Plasmids were transfected into cells using Lipofectamine 2000 (11668019; Invitrogen) according to the manufacturer's protocol.
6
Overexpression of Human APPL1 in HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT and mutant human APPL1 plasmids (transcript ID: NM_012096.3) were generated by the transient overexpression vector GV141 (GeneChem, China)[20 ]. HEK293 cells were transfected with the plasmids and cultured in complete medium supplemented with 10% fetal bovine serum (Excell, FSD500, South America), penicillin, and streptomycin. Cells were seeded in six-well plates once they reached 80%-90% confluence. Transfection was performed when the degree of cell fusion reached 70%-90%. We added 2 μg of corresponding plasmids to each well of the six-well plate and transfected them into HEK293 cells. The transfection operation was performed followed the instructions of the Lipofectamine 3000 (Invitrogen, American) transfection kit. To ensure optimal transfection efficiency, the process was carried out on a sterile bench (SW-CJ-IC dual person purification workbench).
7
Cloning and Validation of CEL Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type and mutant (c.2187_2219delGGGTGACTCTGA GGCTGCCCCTGTGCCCCCCAC and c.1621C>T) human CEL plasmids (transcript ID: NM_001807.6) were synthesized using transient overexpression vector GV141 (GeneChem, China). The detailed protocol is available on request. The entire coding sequences of all the constructs were verified using sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!