Vahts rna clean beads

Manufactured by Vazyme

Sourced in China

VAHTS RNA Clean Beads are magnetic beads designed for the purification of RNA from various sample types. The beads can effectively remove impurities and unwanted fragments, allowing for the recovery of high-quality RNA suitable for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Vahts dna clean beads, by Vazyme (3 mentions) Dnase 1, by New England Biolabs (2 mentions) Transcriptaid t7 high yield transcription kit, by Thermo Fisher Scientific (1 mentions) Megascript rnai kit, by Thermo Fisher Scientific (1 mentions) T7 high yield rna transcription kit, by Vazyme (1 mentions) Rnase h, by New England Biolabs (1 mentions) Agilent 2100 bioanalyzer, by Thermo Fisher Scientific (1 mentions) Agilent 4200 bioanalyzer, by Agilent Technologies (1 mentions) X ten, by Illumina (1 mentions) Qubit 3.0 fluorometer, by Thermo Fisher Scientific (1 mentions) Nanodrop 2100, by Thermo Fisher Scientific (1 mentions) Vahts total rna seq h m r library prep kit, by Vazyme (1 mentions) Novaseq 6000, by Illumina (1 mentions) Mirneasy mini kit, by Qiagen (1 mentions) Qiaseq mirna library kit, by Qiagen (1 mentions) Hiseq 2500, by Illumina (1 mentions) 5200 fragment analyzer system, by Agilent Technologies (1 mentions) Dnase 1, by Vazyme (1 mentions) Agilent dna 1000 chip, by Agilent Technologies (1 mentions)

10 protocols using vahts rna clean beads

Synthesis and Characterization of FMN Riboswitch

Check if the same lab product or an alternative is used in the 5 most similar protocols

3′Biotin tagged TAR RNA (5′-GGCAGAUCUGAGCCUGGGAGCUCUCUGCC-3′ biotin), 5-FAM and 5′ propargylglycine tat peptide (5′ pra-AAARKKRRQRRRAAA, Pra-tat, propargylglycine is introduced for DNA conjugation) (21 (link)) were synthesized by GenScript.
E.coli FMN Riboswitch with and without poly A were prepared by in vitro transcription. E.coli FMN Riboswitch sequence with poly A (5′TAATACGACTCACTATAGGGCTTATTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAAATCAACTCAGTTGAAAGCCCGCGAGCGCTTTGGGTGCGAACTCAAAGGACAGCAGATCCGGTGTAATTCCGGGGCCGACGGTTAGAGTCCGGATGGGAGAGAGTAACGAAAAAAAAAAAAAAAAAAAAAAAAA-3′) were introduced to pcDNA3.4 at clone site SacI and XbaI. DNA templates were prepared by PCR from the plasmid using forward primer (TAATACGACTCACTATAGGG) incorporating the T7 promoter and three different reverse primers (R1 CGTTACTCTCTCCCATCCG, R2 TTTTTTTTTTTTTTTTTTTTTTTTT or R3 TTTTTTTTTTTTTTTTTTTTTTTTTCGTTACTCTCTCCCA). In vitro transcription was carried out by using TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific K0441) and purified by VAHTS RNA Clean Beads (Vazyme N412-02) following the protocol from the manufacturer. FMN Riboswitch was prepared in 50 mM Tris, 100 mM KCl pH 7.4 buffer and annealed each time before use by heating at 95 °C for 5 min and put at RT (room temperature) for at least 15 min.

Chen Q., Li Y., Lin C., Chen L., Luo H., Xia S., Liu C., Cheng X., Liu C., Li J, & Dou D. (2022). Expanding the DNA-encoded library toolbox: identifying small molecules targeting RNA. Nucleic Acids Research, 50(12), e67.

+ Open protocol

+ Expand

dsRNA Synthesis and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Before microinjection, the template was amplified with T7-specific primers to prepare the template (Table S2). PCR products were analyzed on 1% agarose gel. Then, the PCR products were cloned and sequenced to confirm their identities and purified with VAHTS^®® RNA Clean Beads (Vazyme Biotech Co., Ltd. Nanjing, China). The dsRNA was synthesized by using a MEGA script^®® RNAi Kit (Thermo Fisher, Shanghai, China) according to the instruction manual and quantified by using an ultra-micro spectrophotometer (BIO-DL) at a wavelength of 260 nm. The calculated concentrations of the dsRNA are shown in Table S3.

Ruan Y., Liu X., Gong C., Zhang Y., Shen L., Ali H., Huang Y, & Wang X. (2021). Cloning and Functional Verification of CYP408A3 and CYP6CS3 Related to Chlorpyrifos Resistance in the Sogatella furcifera (Horváth) (Hemiptera: Delphacidae). Biology, 10(8), 795.

+ Open protocol

+ Expand

Synthesis and Purification of Biotinylated RNA Probes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA probes containing ac4C were synthesized as previously described (Sinclair et al., 2017 (link)). Briefly, DNA templates of the probes were in vitro transcribed using the T7 High Yield RNA Synthesis Kit (APExBIO; Cat# K1047) according to the manufacturer’s instructions. For acetylated transcripts, ac4CTP (MCE, Cat# HY-111815A) replaced CTP in the reaction mix. For both acetylated and unacetylated probes, 25% of UTP was replaced with biotin-16-UTP (Lucigen, WI, United States; Cat# BU6105H). Synthesized probes were purified by VAHTS RNA Clean Beads (Vazyme; Cat# N412) according to the manufacturer’s instructions. Specifically, the volume of RNA Clean Beads was 2.5-fold of the RNA solution considering the short length of RNA probes. The sequences of probes used in this study were listed in Supplementary Table 2.

Xiang Y., Zhou C., Zeng Y., Guo Q., Huang J., Wu T., Liu J., Liang Q., Zeng H, & Liang X. (2021). NAT10-Mediated N4-Acetylcytidine of RNA Contributes to Post-transcriptional Regulation of Mouse Oocyte Maturation in vitro. Frontiers in Cell and Developmental Biology, 9, 704341.

+ Open protocol

+ Expand

Generating mRNA for Tet1 Rescue

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate mRNAs for microinjection experiments aimed at rescuing Tet1 function, we first constructed plasmids by cloning the wild-type Tet1 or a Tet1 mutant with a YRA coding sequence replacing the HKD coding sequence into the pCDNA3.1 vector. Next, we linearized the plasmids using the ACC65I restriction endonuclease reaction system (NEB). The resulting purified DNA fragments were used as a template for in vitro transcription with the T7 High Yield RNA Transcription Kit (Vazyme), following the manufacturer’s instructions. We then purified the RNA using VAHTS RNA Clean Beads (Vazyme). Finally, we aliquoted and stored the synthesized RNA at –80 °C until use.

Wei X., Zhang Z., Gu Y., Zhang R., Huang J., Li F., He Y., Lu S., Wu Y., Zeng W., Liu X., Liu C., Liu J., Ao L., Shi F., Chen Q., Lin Y., Du J., Jin G., Xia Y., Ma H., Zheng Y., Huo R., Cao J., Shen H, & Hu Z. (2024). Inter- and trans-generational impacts of real-world PM2.5 exposure on male-specific primary hypogonadism. Cell Discovery, 10, 44.

+ Open protocol

+ Expand

Efficient rRNA Depletion for Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Except for HeLa, HEK293T, and A549 cells, which used 15 μg total RNA, all the other samples were processed with 10 μg. The RNA was diluted to 29 μl, and 1 μl rRNA probe (H/M/R) was added (Vazyme Biotech Co., Ltd.). RNA was hybridized with the probe and heated to 95 °C for 2 min, then gradually cooled to 22 °C at 0.1 °C/s and maintained for 5 min. Next, the rRNA was eliminated by adding 1 μl RNase H (New England Biolabs), 4 μl 10X RNase H buffer, 4 μl RNase-free water and incubating at 37 °C for 30 min. Subsequently, the hybridization and RNase H reaction were repeated 5/3 times to eliminate the rRNA fragment as much as possible. Finally, the probe was digested by 2 units of DNaseI (New England Biolabs) at 37 °C for 30 min. According to the manufacturer's protocol, the RNA product was purified using VAHTS RNA Clean Beads (Vazyme Biotech Co., Ltd.).

Tang Y., Wu Y., Wang S., Lu X., Gu X., Li Y., Yang F., Xu R., Wang T., Jiao Z., Wu Y., Liu L., Chen J.Q., Wang Q, & Chen Q. (2024). An integrative platform for detection of RNA 2′-O-methylation reveals its broad distribution on mRNA. Cell Reports Methods, 4(3), 100721.

+ Open protocol

+ Expand

RNA Extraction and Sequencing from Mouse Kidney

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse kidney tissues using MiRNeasy Mini Kit (Cat#217004, Qiagen, Germany). Then, RNA was purified using VAHTS RNA Clean Beads (N412-01, Vazyme, CN), DNase I, and RNase-free (EN401, Vazyme, CN). Quality control (QC) was achieved using NanoDrop 2100 (Thermo Fisher Scientific, United States) and Agilent Bioanalyzer 4200 (Agilent Technologies, United States).
Small RNA (sRNA) (∼21 nucleotides) and whole transcriptome libraries were generated using the QIAseq miRNA Library Kit (Cat#331505, Qiagen, Germany) and VAHTS Total RNA-seq (H/M/R) Library Prep Kit (NR603-01, Vazyme, China) following the manufacturers’ instructions. All libraries were quantified using Agilent 2100 Bioanalyzer and Qubit^® 3.0 fluorometer (Invitrogen; Thermo Fisher Scientific, Inc.). sRNA libraries and whole transcriptome libraries were sequenced on the Illumina Xten and Illumina NovaSeq 6000 (Illumina Inc., San Diego, CA, United States), respectively.

Wei T., Qian N., Yang W., Yang Y., Liu J., Hao W., Cheng T., Yang R., Dong W, & Yang Y. (2022). Construction of a Novel circRNA/miRNA/mRNA Regulatory Network to Explore the Potential Pathogenesis of Wilson’s Disease. Frontiers in Pharmacology, 13, 905513.

+ Open protocol

+ Expand

RNA-seq Library Preparation using SMARTer-seq

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used SMARTer-seq® Stranded Kit User Manual (TaKaRa Bio. Inc., Japan) and modified some procedures to prepare the RNA-seq library. Briefly, 1) the total RNA was treated with DNase I (NEB) for 15 min at 37 °C and purified by VAHTS^@ RNA Clean Beads (Vazyme Biotech Co., Ltd.). 2) The purified RNAs are fragmented at 85°C for 2 min. 3) Then, 10 cycles were used for the first round of PCR to add Illumina Adapters and Indexes (PCR products could be stored at −20°C for up to 2 weeks). 4) Depletion of ribosomal cDNA with ZapR and R-Probes. 5) The final RNA-seq library was amplified by using 16 cycles. 6) The final RNA-seq library was purified by using VAHTS^@ DNA Clean Beads (Vazyme Biotech Co. Ltd.). 7) The cDNA library concentration was measured using a Qubit^® 2.0 Fluorometer (>1 ng/μl). The constructed library was sequenced by using the Illumina HiSeq 2500 (Illumina Inc., San Diego, CA, United States) sequencer (2 × 150-bp paired-end pattern (PE150)).

Shi H., Pan M., Sheng Y., Jia E., Wang Y., Dong J., Tu J., Bai Y., Cai L, & Ge Q. (2022). Extracellular cell-free RNA profile in human large follicles and small follicles. Frontiers in Cell and Developmental Biology, 10, 940336.

+ Open protocol

+ Expand

Tet3 Overexpression in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequence of mouse enhanced Tet3 (mTet3-plus) was synthesized and cloned into a pcDNA3.1(+) vector with hemagglutinin (HA)-tag. The mTet3-plus plasmid was linearized and mRNA was synthesized using the EasyCap T7 Co-transcription kit with CAG Trimer (Vazyme, cat. no. DD4203) according to the manufacturer's instructions. Next, mRNA was purified by VAHTS RNA Clean Beads (Vazyme, cat. no. N412-01) and eluted by nuclease-free water. The integrity of the synthesized mRNA was confirmed by a 5200 Fragment Analyzer System (Agilent). For mRNA microinjection, human 3PN embryos were injected with approximately 10 pl mouse enhanced Tet3 mRNA (1.5 μg μl -1 ) using a FemotoJet microinjector (Eppendorf) with constant flow setting. Then, control and injected embryos were cultured until day 2 for immunostaining of HA-mTet3-Plus, 5hmC and 5mC. Four-cell stage embryos were collected for ACE-seq and WGBS. Eight-cell stage embryos were collected for a single-embryo Smart-seq2 assay.

Liang D., Yan R., Long X., Ji D., Song B., Wang M., Zhang F., Cheng X., Sun F., Zhu R., Hou X., Wang T., Zou W., Zhang Y., Pu Z., Zhang J., Zhang Z., Liu Y., Hu Y., He X., Cao Y, & Guo F. (2024). Distinct dynamics of parental 5-hydroxymethylcytosine during human preimplantation development regulate early lineage gene expression. Nature cell biology.

+ Open protocol

+ Expand

In vitro crRNA Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

In vitro transcription was conducted using the T7 High RNA Transcription kit (Vazyme, China). In brief, a T7 promoter ssDNA forward primer and a conventional reverse primer were used to amplify the dsDNA template of crRNA, and the template was transcribed for 16 h at 37°C. Transcribed RNA was then treated with DNase I (Vazyme, China) for 15 min at 37°C and purified using VAHTS RNA Clean Beads (Vazyme, China). Detailed crRNA sequences used in this study are listed in Table S2.

Wang Z., Wang Y., Zhang Y., Qin G., Sun W., Wang A., Wang Y., Zhang G, & Zhao J. (2024). On-site detection and differentiation of African swine fever virus variants using an orthogonal CRISPR-Cas12b/Cas13a-based assay. iScience, 27(4), 109050.

+ Open protocol

+ Expand

Ribosome-Depleted RNA-seq Library Prep

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 14-day-old seedlings are subjected to the Vazyme VAHTS Total RNA-seq Library Prep Kit for deep sequencing (Vazyme, NR603). RNA were digested with RNase H and DNase I and purified with VAHTS RNA Clean Beads (Vazyme, N412). Ribosome-depleted RNA was used as a template for synthesis of both strands of cDNA. Double stranded cDNA was purified with VAHTS DNA Clean Beads (Vazyme, N411). The dA-tailing and adapter ligation were performed using VAHTS RNA Adapters Set 1 - Set 2 (Vazyme, N803, N804). 1 × VAHTS DNA Clean Beads (Vazyme, N411) was used for purification and size selection of adapter-ligated DNA followed by amplification. Agilent DNA 1000 chip (Agilent, 5067-1504) was used for determination of library qualitydetermination.

Liu Z.W., Zhao N., Su Y.N., Chen S.S, & He X.J. (2020). Exogenously overexpressed intronic long noncoding RNAs activate host gene expression by affecting histone modification in Arabidopsis. Scientific Reports, 10, 3094.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!