Mcdb 131

Cells were seeded in 6-cm dishes (Corning, USA) in culture medium (DMEM or MCDB-131, Brazil) plus 10% FBS for 48 h at 37 °C and 5% CO₂. The cells were then incubated with 10, 100 or 1000 nM ALT-C. After 24 h, culture medium was removed and cells were lysed with cold TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s protocol for total RNA isolation. RNA concentrations and purity were determined by the ratio of the absorbance at 260 and 280 nm using a Nanodrop 2000 the RNA integrity was confirmed on 1% agarose-formaldehyde gel stained with ethidium bromide.
Total RNA was reverse transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, USA). cDNA was stored at − 20 °C until use. Oligonucleotide primers were designed using Primer Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). The primer sequences were: GAPDH forward 5′ GATGCTGGTGCTGAGTATGT and reverse 5′ GTGGTGCAGGATGCATTGCT; c-Myc forward 5′ CCTACCCTCTCAACGACAGC and reverse 5′ CTTGTTCCTCCTCAGAGTCGC; MMP-2 forward 5’ AGGACCGGTTCATTTGGCGG and reverse 5′ TGGCTTGGGGTACCCTCGCT; MMP-9 forward 5’ CGCTACCACCTCGAACTTTG and reverse 5′ GCCATTCACGTCGTCCTTAT.

Human HT-1080 fibrosarcoma cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 4.5 g/L glucose, 2 mM glutamine and penicillin/streptomycin (Corning, Somerville, MA, USA), supplemented with 10% fetal bovine serum (FBS; Capricorn Scientific GmbH, Ebsdorfergrund, Germany). The transformed microvascular endothelial cell line HMEC-1 was kindly supplied by Dr. Arjan W. Griffioen (Maastricht University, The Netherlands). HMEC-1 was cultivated in MCDB-131 (Corning, Somerville, MA, USA) medium supplemented with 1 µg/mL hydrocortisone, 10 ng/mL of EGF-1 (Sigma/Merck, Darmstadt, Germany), 1% penicillin/streptomycin solution, 2 mM L-glutamine and 10% FBS. Cells were kept in a humid incubator at 37 °C under conditions of 5% carbon dioxide. Subconfluent (at 75–80% of confluency) cells were used for subculturing and for treatments and experiments.