The largest database of trusted experimental protocols

Pcdh cmv mcs ef1 puro lentivirus vector

Manufactured by System Biosciences
Sourced in United States

The PCDH-CMV-MCS-EF1-Puro lentivirus vector is a lentiviral expression vector. It contains a CMV promoter, a multiple cloning site, and a puromycin resistance cassette driven by the EF1 promoter.

Automatically generated - may contain errors

7 protocols using pcdh cmv mcs ef1 puro lentivirus vector

1

Synthesis of CTCF Analogue ZF-Sss1

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CTCF analogue ZF-Sss1 was synthesized as previously described (Zhang et al., 2011 (link)). In brief, Sss1 DNA methyltransferase DNA was amplified from Spiroplasma monobiae strain MQ1 (33825; ATCC) genomic DNA, and the cDNA fragment encoding the CTCF ZF domain was generated from the pOBT7-CTCF vector by PCR amplification. These two DNA fragments were then linked by SV40 NLS and a short linker sequence to produce the ZF-Sss1 construct, which was then cloned into the NheI–BamH sites in pCDH-CMV-MCS-EF1-Puro lentivirus vector (System Biosciences, Inc.).
+ Open protocol
+ Expand
2

Lentiviral Vector Production for B-Raf and B-RafV600E

Check if the same lab product or an alternative is used in the 5 most similar protocols
B-Raf wild-type, V600E mutant, c-Myc, and DUSP6 were cloned from normal thyroid and PTC in our laboratory. After insertion of cDNA into the TOPO cloning vector (Invitrogen, Carlsbad, CA) and sequencing, cDNAs were inserted into the pCDH-CMV-MCS-EF1-Puro lentivirus vector (System Biosciences, Mountain View, CA). To generate lentiviral particles, HEK-293TN cells were transfected with plasmid DNA (pGag-pol, pVSV-G, and pCDH-B-Raf or pCDH-B-RafV600E) [30] (link).
+ Open protocol
+ Expand
3

Lentiviral Knockdown and Overexpression of SDF1 and p53 in Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human SDF1 cDNA was cloned from normal fibroblasts in our laboratory. cDNA was inserted into the pCDH-CMV-MCS-EF1-Puro lentivirus vector (System Biosciences). For the knockdown of SDF1 expression, shRNA was prepared in a pLKO lentiviral vector (Sigma-Aldrich). Fibroblasts were plated and grown in 6 cm culture dishes. After culturing overnight, they were infected with the lentivirus and the cells were then selected with 3.5 μM puromycin for one week. The shRNA sequences were as follows: sh-SDF1 #1: 5′-CGCCAACGTCAAGCATCTCAAA-3′; sh-SDF1 #2: 5′-ACATCTCAAAATTCTCAACACA-3′. To generate lentiviral particles, HEK-293TN cells were transfected with plasmid DNA (pGag-pol, pVSV-G, and pCDH-SDF1 or shSDF1) using Lipofectamine (Invitrogen). Viral supernatant was collected after 48 h and transduced into normal human melanocytes and fibroblasts. cDNAs of wild-type p53 were inserted into replication-defective E1- and E3-adenoviral vectors containing a cytomegalovirus enhancer and a chicken β-actin promoter. Adenoviruses of p53 were then amplified in 293 human kidney epithelial cells, and the virus particles were purified by filtration (0.45 μm). Similarly, an adenovirus of bacterial β-galactosidase (Ad-LacZ) was also prepared as a control.
+ Open protocol
+ Expand
4

Lentiviral Overexpression and Knockdown of CXCL12 and CSF1

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNAs of human and mouse CXCL12, human CSF1, and mouse CSF1 were cloned from normal human fibroblasts and mouse fibroblasts in the laboratory. cDNAs were inserted into the pCDH‐CMV‐MCS‐EF1‐Puro lentivirus vector (System Biosciences, Mountain View, CA). To generate lentiviral particles, HEK‐293TN cells were transfected with plasmid DNA (pGagpol, pVSV‐G, and pCDH‐human CXCL12, pCDH‐mouse CXCL12, pCDH‐human CSF1, pCDH‐mouse CSF1). For knockdown of CSF1 and CXCL12 expression, shRNA was prepared in a pLKO lentiviral vector (Sigma) and then amplified in 293TN cells. Cells were plated and grown in 6 cm culture dishes. After overnight culture, they were infected with lentivirus and then the cells were selected with 4 × 10−6m puromycin for 1 week. shRNA sequences were as follows: sh‐CSF1 #1: 5′‐TCTCCTGGTACAAGACATAATCTC‐3′; sh‐CSF1 #2: 5′‐AGATCCAGTGTGCTACCTTAACTC‐3′ sh‐CXCL12 #1: 5′‐ACATCTCAAAATTCTCAACACA‐3′; sh‐CXCL12 #2: 5′‐CGCCAACGTCAAGCATCTCAAA‐3′, sh‐mCSF1 #1: 5′‐GATAGACCATGCGCTTTAAACTC‐3′ sh‐mCSF1 #2: 5′‐ GCCTACCAAGACTGGATGAAACTC‐3′, respectively.
+ Open protocol
+ Expand
5

Lentiviral Transduction of B-RafV600E

Check if the same lab product or an alternative is used in the 5 most similar protocols
B-RafV600E mutant was cloned from PTC tissue in our laboratory. After insertion of cDNA into TOPO cloning vector (Invitrogen, Carlsbad, CA, USA) and subsequently sequenced. cDNAs were inserted to pCDH-CMV-MCS-EF1-Puro lentivirus vector (System Biosciences, Mountain View, CA, USA). To generate lentiviral particles, HEK293TN cells were transfected with plasmid DNA (pGag-pol, pVSV-G and pCDH-B-RafV600E).
+ Open protocol
+ Expand
6

Lentiviral Transduction of BRAFV600E and CXCR4 in Thyroid Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
BRAFV600E mutant and CXCR4 were cloned from normal thyroid and PTC in our laboratory16 (link). cDNAs were inserted into the pCDH-CMV-MCS-EF1-Puro lentivirus vector (System Biosciences, Mountain View, CA, USA). To generate lentiviral particles, HEK-293TN cells were transfected with plasmid DNA (pGagpol, pVSV-G and pCDH-BRAFV600E or pCDH-CXCR4). For knockdown of BRAF and CXCL12 expression, shRNA was prepared in a pLKO lentiviral vector (Sigma) and then amplified in 293TN cells. Thyrocytes were plated and grown in 6 cm culture dishes. After overnight culture, they were infected with lentivirus and then the cells were selected with 3.5 μM puromycin for 1 week. shRNA sequences were as follows: shBRAF: 5′-TTACCTGGCTCACTAACTAAC-3′; shCXCL12-1: 5′-CGCCAACGTCAAGCATCTCAAA-3′; shCXCL12-2: 5′-ACATCTCAAAATTCTCAACACA-3′, respectively.
+ Open protocol
+ Expand
7

Cloning and Lentiviral Expression of PTENP1 3' UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 3′ UTR of PTENP1 was cloned using KOD-Plus-Neo DNA polymerase (TOYOBO, Osaka, Japan) from the genomic DNA of normal oral mucosal epithelial cells. The primers used for cloning were as follows: forward 5′-CGCTACTACCGGAATTCGAGGAGCCGTCAAATCCAGAG-3′ with a BamHI site and reverse 5′-ACTACTACGCGGATCCTCGTCAATGTGTGAGGTTCC-3′ with an EcoRI site. Then, the 3′ UTR of PTENP1 was inserted into the MCS of the pCDH-CMV-MCS-EF1-Puro lentivirus vector (eukaryotic expression plasmid, PCMV for short) to generate the PCMV-PTENP1 plasmid (System Biosciences, Palo Alto, CA, USA), and the PCMV with no insertion was called PCMV-Mock used as a control.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!