Quantifast probe pcr kit

Replication of the rPCV2-Vac virus following immunization was quantified by a TaqMan quantitative PCR (qPCR), using a SRS2 marker specific primer and probe combination and serum collected on DPV 0.14 and 28. Samples were assessed in duplicate. Viral DNA was extracted using the QiaAmp DNA mini Kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instruction. Primer pairs with sequences of 5′-AAGTGGGAGGTTTGCCTTTGT-3′ and 5′-ATGGCCCAATCCTCGGAGAA-3′ and a probe with a sequence of 5′-TACCTGTTCCCCGTCGCGT-3′ were used. Briefly, 2.0 µL of extracted DNA, 0.4 μM of primers, 0.1 μM probe and a Tm of 67 °C were used in combination with the QuantiFast Probe PCR Kit (Qiagen, USA) and cycled in a qPCR thermocycler (CFX96 Touch, Bio-Rad, Hercules, CA, USA). The obtained Ct values were converted to log copy numbers using a standard curve generated with plasmid DNA encoding the SRS2 peptide marker. The specificity of the assay was evaluated using the infectious clones for the wildtype PCV2b and heterologous PCV2a and PCV2d. The lowest limit of detection of the assay was 2000 genomic copies per mL of serum.

In order to standardise the DNA extraction method, 50 μl of each cell culture sample was extracted using a robotic extraction technique (BioRobot Universal System, Qiagen). The presence of viral DNA in the samples was quantified using a previously-described general capripoxvirus real-time PCR (Bowden et al., 2008; Stubbs et al., 2012 ). Primers and a probe were used in combination with a QuantiFast Probe PCR Kit (Qiagen, Crawley, UK) in a Mx3005p Multiplex Quantitative PCR System (Strategene, Netherlands) (Bowden et al., 2008; Stubbs et al., 2012 ). This real-time PCR assay targets an 89 bp region within the LSDV P32 gene and utilises forward primer 5′-AAA ACG GTA TAT GGA ATA GAG TTG GAA-3′, reverse primer 5′-AAA TGA AAC CAA TGG ATG GGA TA-3′ and TaqMan probe 5′-6FAM-TGG CTC ATA GAT TTC CT-MGB/NFQ-3′. The assay is validated for use as a primary diagnostic method for the detection of LSDV DNA from samples submitted to the OIE Capripoxvirus Reference Laboratory at The Pirbright Institute, and is an ISO 17025 accredited method. A cut-off limit of C_t 39 (Stubbs et al., 2012 (link)) was used.

Tonsillar swabs were transported to the laboratory and stored at -20°C until use. DNA was extracted using MagMAX-96 Viral RNA isolation kit and MagMAX Express-96 Magnetic Particle Processor (Life Technologies, Grand Island, NY, USA). For M. hyorhinis genetic material detection, a real-time PCR was performed with QuantiFast Probe PCR kit (Qiagen Inc., Germantown, MD, USA), according to manufacturer’s protocol, employing custom primers and probe [23 (link)]. Similarly, a real-time PCR assay was performed to detect M. hyosynoviae with Path-ID qPCR Master Mix Kit (Life Technologies, Grand Island, NY, USA), according to manufacturer’s protocol. The primers and probes were synthetized based on the Standard Operating Procedures (SOP) routinely followed at the University of Minnesota, Veterinary Diagnostic Laboratory for M. hyosynoviae detection (UMN-VDL SOP .0078). Samples were considered positive by real-time PCR for M. hyorhinis and M. hyosynoviae when Ct ≤ 37.

Total RNA was extracted from cells and tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Germany), and samples were reverse transcribed using the PrimScriptTM RT Reagent Kit (TaKaRa, China) as described in the manufacturer’s protocol. Real-time PCR to determine EphA5 and GAPDH mRNA levels was performed using the QuantiFast Probe PCR Kit (Qiagen, Germany) according to the manufacturer’s instructions; all analyses were conducted using the ABI Prism 7500 sequence detection system (Applied Biosystems, CA). The relative quantification of EphA5 mRNA levels was performed using the comparative Ct method (2^-△△Ct method) with GAPDH as the reference gene. Increases or decreases in mRNA levels of at least two fold were considered to be significant. The primer sequences were as follows: EphA5 forward, 5’-TCTGTGGTACGACACTTGGC-3’; EphA5 reverse, 5’-CTTGCACATGCATTTCCCGA-3’; GAPDH forward, 5’-GAGAAGGCTGGGGCTCATTT-3’; GAPDH reverse, 5’-AGTGATGGCATGGACTGTGG-3’.

Quantitative real-time PCR was performed with a QuantiFast Probe PCR Kit (204256, Qiagen) (for Serpina1(a-e)) or TaqMan™ Gene Expression Master Mix (4370074, Applied Biosystems) (for Ldlr, Pcsk9 and dCas9-VPR expression) using the following TaqMan™ Gene Expression Assays (Applied Biosystems): Mm01177349_m1 for Ldlr, Mm02748447_g1 for Serpina1a, Mm04207706_gH for Serpina1b and Serpina1d, Mm00833655_m1 for Serpina1e, Mm00842094_mH for Serpina1d and Mm04207703_mH for Serpina1a, Serpina1b, Serpina1c, Mm01263610_m1 for Pcsk9, Mm00839502_m1 for Polr2A. dCas9-VPR expression was analyzed using a Custom TaqMan™ Gene Expression Assay (Applied Biosystems), containing dCas9-Fwd, dCas9-Rev and dCas9-probe (Supplementary Table S1). Relative Serpina1(a-e), Pcsk9 and Ldlr expressions were calculated using 2^−ΔΔCt method in relation to Polr2a.

Tissues were homogenized in RLT buffer, and RNA was extracted using the RNeasy method on the QIAxtractor (Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. RNA was extracted from swab samples using the QiaAmp Viral RNA kit on the QIAxtractor. For one-step real-time qPCR, 5 μL RNA was used in the QuantiFast Probe PCR kit (Qiagen), according to instructions by the manufacturer. Standard dilutions of a virus stock with known titer were run in parallel in each run, to calculate TCID₅₀ equivalents in the samples. Primers and probe were designed for detection of WIV1-CoV (Forward primer: TCAGGCTGGAAATGCTACAG, reverse primer: GTCCTCCACTTGCTAGGTAATC, probe: TGTGCTTTCCTTCTGTGCCTTTGC). Primers and probes specific for Rousettus aegyptiacus GAPDH and HPRT were designed as extraction controls (GAPDH: forward primer: GGTTGTCTCCTGCGACTTTA, reverse primer: CCTGTTGCTGTAGCCAAAT TC, probe: AAAGTGGTCATTGAGGGCAATGCC. HPRT forward primer: AGATGGTGAAGGTCGCAAG, reverse primer: CCTGAAGTATTCATTATAGTCAAGGG, probe: ACTTTGTTGGATTTGAAATTCCAGACA AGTTTG. All qRT-PCR cycles were as follows: 15 min at 50 °C, 5 min at 95 °C, then 40 cycles of 15 s at 95 °C and 15 s (WIV1) or 30 s (Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and Hypoxanthine-guanine phosphoribosyltransferase (HPRT)) at 60 °C.