We used qRT-PCR to analyze the expression profiles of MSTRG.20413.1, ptc-miR396e-5p, and the corresponding target gene (GRF9) within 24 h of blue and white light irradiation. Primers were designed using Primer 6.0 software, as shown in Table S3 . RNA was reverse-transcribed into cDNA using the miRcute Plus miRNA First-Strand cDNA Kit (TIANGEN Biotech, Co., Ltd., Beijing, China) to generate a fluorescent quantification template for ptc-miR396e-5p. Amplification was performed using the miRcute Plus miRNA qPCR (SYBR Green) Kit (TIANGEN Biotech, Co., Ltd., Beijing, China). The reaction system included 10 μL of 2×miRcute Plus miRNA PreMix (SYBR&ROX), 0.4 μL each of forward and reverse primers, 1 μL of miRNA first-strand cDNA, and 8.2 μL of ddH2O. The amplification program consisted of an initial denaturation at 95 °C for 15 min, followed by 43 cycles of denaturation at 94 °C for 20 s, and annealing at 60 °C for 34 s. U6 was selected as the reference gene. The reaction system and program for GRF9 were set up and performed in the same manner as described in Section 4.6 for the fluorescent quantification of target genes. The Stratagene Mx3005P Real-Time PCR instrument (Agilent Technologies) was used for qRT-PCR. The relative expression level of the gene was calculated using the 2−ΔΔCT method.
Mircute plus mirna qpcr kit sybr green
Manufactured by Tiangen Biotech
Sourced in China
The MiRcute Plus miRNA qPCR Kit (SYBR Green) is a real-time PCR kit designed for the quantitative detection of microRNA (miRNA) expression. The kit utilizes SYBR Green chemistry for the amplification and detection of miRNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Mircute plus mirna first strand cdna kit, by Tiangen Biotech (24 mentions)
Trizol reagent, by Thermo Fisher Scientific (13 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (6 mentions)
Mircute plus mirna first strand cdna synthesis kit, by Tiangen Biotech (5 mentions)
Mirneasy mini kit, by Qiagen (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Superreal premix color sybr green qrt pcr kit, by Tiangen Biotech (4 mentions)
Trizol reagent, by Tiangen Biotech (4 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Fastking gdna dispelling rt supermix kit, by Tiangen Biotech (3 mentions)
Superreal premix plus sybr green kit, by Tiangen Biotech (3 mentions)
Primescripttm rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
First strand cdna systhesis kit, by Tiangen Biotech (2 mentions)
Primescript rt master mix perfect real time, by Takara Bio (2 mentions)
Mircute mirna first strand cdna synthesis kit, by Tiangen Biotech (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Hiscript 3 1st strand cdna synthesis kit gdna wiper, by Vazyme (2 mentions)
Mirneasy serum plasma advanced kit, by Qiagen (2 mentions)
Abi 7900 system, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
43 protocols using mircute plus mirna qpcr kit sybr green
1
qRT-PCR Analysis of Light-Responsive Genes
2
Exosomal miRNA Isolation and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRcury exosome isolation kit (76743, Qiagen) isolates exosomal miRNAs from CSF. The column purification was then performed through the miRcury RNA isolation kit. TRIzol was added into cells to isolate total RNA. Then RNA was detected in the NanoDRrop spectrophotometer to detect the concentration and purity of the eluted RNA. Complementary DNA (cDNA) was synthesized by the miRcute Plus miRNA First-Strand cDNA synthesis Kit (KR201-02, Tiangen Biotech) or FastKing gDNA Dispelling RT SuperMix Kit (KR118-02, Tiangen Biotech). miRcute Plus miRNA qPCR (SYBR Green) kit (KR211, Tiangen Biotech) or SuperReal PreMix Plus (SYBR Green) kit (FR205, Tiangen Biotech) and perform the amplification reaction on ABMI PRISM 7000 to quantitatively analyse RNA. 2 -ΔΔCt method normalized the relative expression of miR-152-3p and PTEN to U6 or GAPDH. The sequences of primer were the following: miR-152-3p forward 5'-TCGGCAGGTCAGTGCAT-GACAGAA-3', reverse 5'-CTCAACTGGTGTCGTGGA-3'; PTEN forward 5'-TCCCAGACATGACAGCCATC-3'; reverse 5'-TGCTTTGAATCCAAAAACCTTACT-3'; U6 forward 5'-CTCGCTTCGGCAGCACA-3'; reverse 5'-AAC-GCTTCACGAATTTGCGT-3'; GAPDH forward 5'-AAT-GTGTCCGTCGTGGATCTGA-3'; reverse 5'-GATGCCT-GCTTCACCACCTTCT-3'. The thermocycling conditions used were as follows: 95°C for 10 min followed by 40 cycles of 94°C for 15 s, 55°C for 30 s and 70°C for the 30s.
3
Quantifying Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the uteri and endometrial cells using TRIzol (Invitrogen) according to manufacturer's instructions. The quantity of RNA was examined using a NanoDrop2000 instrument (Thermo Fisher Scienti c, Waltham, MA, USA). For mRNA detection, total RNA (2 μg) cDNA was synthesized using a FastKing gDNA Dispelling RT SuperMix kit (TIANGEN BIOTECH, Beijing, China). Gene expression was assessed by qPCR with 2μl of the synthetized cDNA using a Real Universal Color PreMix (SYBR Green) kit (TIANGEN BIOTECH). For miRNA detection, total RNA (1 μg) was used to synthesize cDNA using a miRcute Plus miRNA First-Strand cDNA kit (TIANGEN BIOTECH) and miR-192-5p was quali ed by qPCR using miRcute Plus miRNA qPCR (SYBR Green) kit (TIANGEN BIOTECH). The qPCR reactions were performed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems Inc., Foster City, CA, USA). GAPDH/U6 were set as the normalizing control. Relative quantities were calculated using the 2 -△△CT method. The sequences of all primers used are listed in Table 1.
4
RNA Isolation and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, Carlsbad, USA) was used to isolate the total RNA from the cultured cells and tissue samples, and miRNA was extracted by miRcute miRNA Isolation Kit (TIANGEN, Beijing, China). The reverse transcription reaction of total RNA was conducted using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, RR047A, Japan), whereas miRcute Plus miRNA First-Strand cDNA Kit (TIANGEN, Beijing, China) was used for the reverse transcription reaction of miRNA. The obtained cDNA from total RNA was subjected to PCR amplification using SYBR green (Takara, RR420A, Japan) with ABI 7500 Real-Time PCR System (ThermoFisher), while the cDNA from miRNA was amplified with miRcute Plus miRNA qPCR Kit (SYBR green, TIANGEN, Beijing, China). U6 and β-actin were used as endogenous controls for miRNAs and mRNAs, respectively. 2-ΔΔCt method was used to calculate the relative expression. The primers used were listed in Table S1 .
5
Hippocampal miRNA Isolation and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hippocampus of brain tissue was removed after rapid decapitation of SD rats, and the tissue was isolated on ice. Total RNA was extracted using the miRcute miRNA Isolation Kit (DP501, Tiangen, China) and subsequently reversed transcribed using the miRcute Plus miRNA First-Strand cDNA Kit (KR211, Tiangen, China) and FastKing gDNA Dispelling RT SuperMix Kit (KR118, Tiangen, China). RT-qPCR was performed on the ABI QuantStudio5 System using miRcute Plus miRNA qPCR Kit (SYBR Green) (FP411, Tiangen, China) and Talent qPCR PreMix Kit (SYBR Green) (FP209, Tiangen, China). The primer design was completed by Sangon Biotech, and the primer list was shown in Supplementary Table S2 .
6
miRNA Expression Quantification by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNA was synthesized using a miRcute Plus miRNA First-Strand cDNA Kit (Tiangen Biotech KR211, Beijing, China), while qPCR was performed using a miRcute Plus miRNA qPCR Kit (SYBR Green; Tiangen Biotech FP411). The miR-21-5p primer sequence used was GTAGCTTATCAGACTGATGTTGA, and the internal reference U6 primer sequence used was CTCGCTTCGGCAGCACA. The miR-39 primer was used as external reference (Qiagen). The amplification reaction conditions were as follows: 15 min at 95°C, followed by 40 cycles of denaturation at 94°C for 20 s, followed by the annealing and extension of the primers at 60°C for 34 s. The melting curves were constructed, and each reaction was performed in triplicate. The RT-qPCR data were analyzed using the ΔΔCT method.
7
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PrimeScriptTM RT reagent Kit with gDNA Eraser (TAKARA, China) was used to synthesize cDNA from isolated total RNA or circRNA, and the cDNA was then processed for qRT-PCR using SYBR® Premix Ex TaqTM (TAKARA, China) following the manufacturer’s protocols. Reverse transcription and quantitative detection of miRNA were performed with the miRcute Plus miRNA First-Strand cDNA Kit (Tiangen, China) and miRcute Plus miRNA qPCR Kit (SYBR Green) (Tiangen, China) following the manufacturer’s instructions. Primer sequences are available in Supplementary Table 1 .
8
Endometrial RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from the mouse endometrium tissues using Trizol reagent (TIANGEN, Beijing, China; Cat. No. DP421), according to the manufacturer’s protocols. The antisense strand of RNAs was synthesized by the first strand cDNA systhesis kit (TIANGEN, Beijing, China; Cat. No. KR118). The relative expression of mRNA level was detected using SuperReal PreMix Color (SYBR Green) qRT-PCR kit (TIANGEN, Beijing, China; Cat. No. FP215). miRNAs were isolated from endometrial tissues, cells, and sEVs using miRNeasy Mini Kit (QIAGEN, Frankfurt, Germany; Cat. No. 217184). Then, RNA was eluted in RNase-free water and reverse-transcribed to cDNA following the kit protocol (TIANGEN, Beijing, China; Cat. No. KR211). cDNA samples were run using miRcute Plus miRNA qPCR Kit (SYBR Green) (TIANGEN, Beijing, China; Cat. No. FP411). GAPDH, U6, or cel-miR-39 were used as a control. Relative miRNA and mRNA expression levels were assessed by the 2−△△Ct method. All samples were tested in triplicate at least. The information of primers as follows:
GAPDH: forward, ACAACTTTGGTATCGTGGAAGG; reverse, GCCATCACGCCACAGTTTC. cel-miR-39: TCACCGGGTGTAAATCAGCTTG. U6: AACGAGAAGCGAACCAAAAAAA. Human GAS1: forward, ATGCCGCACCGTCATTGAG; reverse, TCATCGTAGTAGTCGTCCAGG. Mouse GAS1: forward, CCATCTGCGAATCGGTCAAAG; reverse, GCTCGTCGTCATATTCTTCGTC.
GAPDH: forward, ACAACTTTGGTATCGTGGAAGG; reverse, GCCATCACGCCACAGTTTC. cel-miR-39: TCACCGGGTGTAAATCAGCTTG. U6: AACGAGAAGCGAACCAAAAAAA. Human GAS1: forward, ATGCCGCACCGTCATTGAG; reverse, TCATCGTAGTAGTCGTCCAGG. Mouse GAS1: forward, CCATCTGCGAATCGGTCAAAG; reverse, GCTCGTCGTCATATTCTTCGTC.
9
miRNA and Total RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA and total RNA extraction were extracted from cells using miRcute miRNA Isolation Kit (Tiangen Biotech Co., Ltd.) or TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturers' protocols. cDNA was synthesized using the miRcute Plus miRNA First-Strand cDNA Kit (Tiangen Biotech Co., Ltd.) according to the manufacturer's protocol. The miRNA cDNA reverse transcription conditions were as follows: 42°C for 60 min and 95°C for 3 min. Total RNA was reverse transcribed into cDNA with the following conditions: 42°C for 60 min and 70°C for 5 min. miRNA and mRNA expression levels were determined using miRcute Plus miRNA qPCR Kit (SYBR® Green; Tiangen Biotech Co., Ltd.) and SYBR® Green Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.), respectively. The thermocycling conditions for miRNA were: Initial denaturation at 95°C for 15 min, followed by 45 cycles of denaturation at 94°C for 20 sec and anneal/extend at 60°C for 34 sec. The thermocycling conditions for mRNA were: Initial denaturation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 15 sec and anneal/extend at 60°C for 1 min. The internal controls were U6 and β-actin. Relative expression was calculated and normalized using the 2−ΔΔCq method (15 (link)). The primer sequences are listed in Table I .
10
qRT-PCR Validation of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRcute Plus miRNA First Strand cDNA Synthesis Kit (Tiangen Biotech, Beijing, China) was used to independently verify the data according to the instructions. Subsequently, qRT-PCR assay was conducted with miRcute Plus miRNA qPCR Kit (SYBR Green, Tiangen Biotech, Beijing, China) to measure the candidate miRNAs selected based on the P value and fold change. The following reaction conditions were used: 95°C for 15 min, 5 cycles at 94°C for 20 s, 63°C for 30 s and 72°C for 34 s, followed by 40 cycles at 94°C for 20 s and 60°C for 34 s. All of the primers used for 10 miRNAs (let-7a-5p, let-7b-5p, let-7d-5p, let-7f-5p, let-7g-5p, let-7i-5p, miR-128-3p, miR-25-3p, miR-144-3p, miR-15a-5p) and U6 (as an internal standard) were obtained from Tiangen Biotech. The data were presented as the relative level of target miRNA expression normalized to U6. Each sample was detected in triplicate. Relative quantification of candidate miRNAs expression was according to the 2−ΔΔCt method, with ΔCt = Cttarget − CtU6 and −ΔΔCt = −(sample ΔCt − control ΔCt).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!