Servicebio rt first strand cdna synthesis kit

For the total RNA extraction of tissues, a small portion of heart tissue samples was removed, frozen in liquid nitrogen, and homogenized in the reagent described above with 5 mm stainless steel beads according to the manufacturer’s specifications (Servicebio). Servicebio^®RT First Strand cDNA Synthesis Kit was used to reverse transcribe RNA into cDNA. RT-PCR was performed using a LightCycle^® 480 II fluorescence quantitative PCR instrument (Roche, Switzerland) after detecting the reaction with a 2 × SYBR Green qPCR Master Mix (None ROX). The expression level of mRNAs was normalized to the GAPDH gene, and relative gene expression changes were calculated using the 2^−ΔΔCt method. The t test was used to assess differences in expression. The primer sequences (Table 2) were designed using Primer 5.0.

1mL peripheral whole blood was centrifuged at 3000rpm for 5min and the supernatants were removed. Then 3mL red cell lysis buffer added and mixed before being centrifuged at 3000rpm for 5min. The supernatant was then discarded and the extracted leukocytes were collected. The total RNA of leukocytes was extracted using Trizol reagent (Servicebio, Wuhan, China), and then dissolved in RNase-free water. The concentration of RNA was determined using NanoDrop 2000 (Thermo scientific, Waltham, MA, USA). Extracted RNA was reversibly transcribed into complementary DNA (cDNA) using Servicebio®RT First Strand cDNA Synthesis Kit (Servicebio, Wuhan, China). Quantitative real-time polymerase chain reaction was performed using SYBR Green qPCR Master Mix (Servicebio, Wuhan, China) on a CFX RT-PCR system (Bio-Rad). PCR reaction system was as follows: pre-degenerated at 95°C for 10min, followed by 40 cycles of 95°C for 15s and 60°C for 30s. The expression level of lncRNA ANRIL was normalized to the expression level of GAPDH as a housekeeping gene. The relative quantitative value was expressed by the 2^−ΔΔCt method. ANRIL primer sequences were shown as follows: upstream: 5’-AGGGTTCAAGCATCACTGTTAGG-3’; downstream: 5’-GAAACCCCGTCTCTACTGTTACCT-3’.

GFP expression was analyzed to evaluate the tumor burden in metastatic LNs. Briefly, LNs were excised and freshly frozen in RNAwait reagent (SR0020, Solarbio, Beijing, China). Total RNA was isolated according to the protocol provided in www.abcam.com/protocols. To assess gene expression, cDNA was prepared using the Servicebio ®RT First Strand cDNA Synthesis Kit (G3330, Servicebio, Wuhan, China). Fifteen microliter reaction was set up using 7.5  $\mu \mathrm{l}$ 2× SYBR Green qPCR Master Mix (G3320, Servicebio, Wuhan, China), 2.5  $\mathrm{\mu }\text{M}$ primer forward (GFP: GGGACCGCTCCTTCCTGTT, GAPDH: CCTCGTCCCGTAGACAAAATG) and primer reverse (GFP: ACGGGGATGATCTTCTCGCA, GAPDH: TGAGGTCAATGAAGGGGTCGT), 2.0 $\mathrm{\mu }$ l cDNA template and 4 µl ddH₂O. qPCR was performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Each sample was tested in triplicate. GAPDH was used as an endogenous control. The relative GFP gene expression level was determined using $\mathrm{\Delta }CT=C{T}_{\mathit{GAPDH}}-C{T}_{\mathit{GFP}}$ , where CT is the threshold cycle. The tumor burden in the metastatic LNs was represented by $\mathrm{\Delta }\mathrm{\Delta }CT=\mathrm{\Delta }C{T}_{T-MLN}-\mathrm{\Delta }C{T}_{N-LN}$ .