Dice real time system

The hBM-MSCs were cultured and differentiated as described earlier. The mRNA expression levels of adipogenic factors in differentiating hBM-MSCs were analyzed by RT-qPCR. Total RNA was isolated from hBM-MSCs at day 14 of differentiation using a commercial RNA extraction kit (AccuPrep® Universal Bioneer, Daejeon, Korea) following the enclosed direction. RNase-free DNase I (Thermo Fisher Scientific, Rockford, IL, USA) treated total RNA was then converted to cDNA using CellScript All-in-One cDNA synthesis Master Mix (CellSafe, Yongin, Korea) following the manufacturer's protocol. Target specific cDNA amplification via real-time PCR was carried out in a Dice Real Time System (TP800, Takara Bio, Ohtsu, Japan) with the help of Luna Universal qPCR mix (New England Biolabs, Ipswich, MA, USA) and gene-specific forward and reverse primers given in detail earlier [22 ]. β-actin was used as a reference gene for the calculation of the relative target gene amount.

Total RNA was isolated from the thalli and gemma cups with gemma of 2-week-old Tak-1, gametangiophores of 1-month-old Tak-1 and Tak-2 and thalli of 2-week-old Tak-1, Tak-2 and Mpacl5 mutants by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs) according to the manufacturer’s instruction. Gemma cups were separated from the thalli by a scalpel. These were immediately frozen in liquid N₂ for subsequent RNA extraction. For each sample, 0.5 µg of total RNA was reverse transcribed to cDNA using ReverTra Ace reverse transcriptase (Toyobo, Osaka, Japan) according to the manufacturer’s protocol. Real-time PCR was performed using THUNDERBIRD Next SYBR qPCR Mix (Toyobo) and the primers, MpACL5-F (GGTGACACTGCACCAATCAC) and MpACL5-R (CTCCGGTGTGCAAGATTTTT) in the thermal cycle of 95°C 30 s—40 cycles of 95°C 5 s, 55°C 10 s and 72°C 30 s or using the KAPA SYBR FAST qPCR Kit (KAPA Biosystems) and gene-specific primers (Supplementary Table S2) in the thermal cycle of 95°C 2 min—40 cycles of 95°C 30 s, 55°C 30 s and 72°C 90 s on a thermal cycler Dice Real-Time System (Takara) according to the manufacturer’s method. Transcript levels of MpEF1α or MpACT7 were used as a reference for normalization (Kubota et al. 2014 , Saint-Marcoux et al. 2015 ). Primers used in RT-qPCR are listed in Supplementary Table S2.

Total RNA was isolated from whole seedlings grown for 8 days in the presence or absence of estradiol by phenol/chloroform extraction and subsequent lithium chloride precipitation^{55 (link)}. For each sample, 0.5 µg of total RNA was reverse transcribed to cDNA using ReverTra Ace reverse transcriptase (TOYOBO, http://www.toyobo.co.jp) according to the accompanying protocol. Real-time PCR was performed on a thermal cycler Dice Real Time System (Takara) using KAPA SYBR FAST qPCR Kit (KAPA Biosystems, https://www.kapabiosystems.com) according to the manufacturer’s method. Transcript levels of ACT8 were used as a reference for normalization. Primers used in RT-qPCR are listed in Table S3. The RT-qPCR were performed using at least three biological replicates.

Total RNA was purified using the acid-guanidinium-thiocyanate-phenol-chloroform (AGPC) method and reverse-transcribed to cDNA using a High-Capacity cDNA Reverse Transcription Kit. Target sequences were amplified by SYBR Premix Ex Taq II in a Thermal Cycler Dice Real Time System (TP-870, Takara Bio) using the specific primers listed in Table S1. The level of expression of each target gene was normalized relative to the level of Actb mRNA in the same samples. The data were analyzed by the $2^{-\mathrm{\Delta }{C}_{\text{t}}}$ method [27 (link)], with normalized expression calculated as individual data point according to the formula:
$$\mathrm{\Delta }{C}_{\text{t}}=C_{\text{t}\text{gene}\text{of}\text{interest}}-C_{\text{t}Actb\text{gene}}$$ Fold gene induction =  $2^{-\mathrm{\Delta }{C}_{\text{t}}}$ value (Experimental group)/ $2^{-\mathrm{\Delta }{C}_{\text{t}}}$ value (Control group). Control group: LLCm1 cells at pH 7.4. Experimental group: LLCm1 cells at pH 6.8, LLCm1A cells at pH 7.4, or LLCm1A cells at pH 6.8

qRT-PCR was used to confirm the SIRT1 expression. Total RNA was extracted from cells using RNAiso Plus (9108Q, TaKaRa) and reversely transcripted into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (RR047A, TakaRa) following the manufacturer’s protocol. The relative gene expression was determined using Thermal cycler Dice Real Time System (TP800, TaKaRa) by SYBR Premix Ex TaqTM II (Tli RNaseH Plus, RR820A, TaKaRa). The Transcript levels of SIRT1 were evaluated with β-actin serving as the internal control standard. The primer sequences were as follows: F: TGTGGTAGAGCTTGCATTGATCTT, R: GGCCTGTTGCTCTCCTCATT. Data were shown as fold change (2^−∆∆Ct) and analyzed initially using GraphPad Prism 7 software. Triplicates were performed for each sample in three independent experiments.

RNA isolation and subsequent reverse-transcription were performed using TRI Reagent® and the PrimeScript® RT Master Mix Kit (TAKARA Bio Inc.). Quantitative real-time PCR was performed using Perfect real-time SYBR green II (TAKARA Bio Inc.) and a Thermal Cycler Dice® Real Time System. Expression quantity was evaluated by the ΔΔCt method using Gapdh as a control gene for normalization. To prevent contamination of genomic DNA, primers were designed to span at least one intron. Primer sequences are listed in Supplementary Table S2.