Thioglycollate (TG)-elicited peritoneal myeloid cells were prepared from the Slfn4-tdT mice, as described previously6 (link). Cells were treated with 100nM Tamoxifen (Tx, dissolved in DMSO) for 24h to induce Cre recombinase activity and tdTomato expression ex vivo. The Hsa-MIR130b-3p miRNA mimic (50nM, Applied Biological Materials, MCH01270) and the mimic negative control (MCH00000) were transfected into cells using Lipofectamine LTX with PLUS reagent (Thermo Fisher). The Mmu-Mir130b-3p miRNA antisense (CAGUGCAAUGAUGAAAGGGCAU) (10nM, MSTUD0173, Sigma Aldrich), Slfn4 siRNA or the scrambled controls were transfected using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher) for 48h. To induce Slfn4 expression, the cells were treated with 800U/ml recombinant IFNα (R&D, #12125-1) for 24h or at different time points.
Recombinant ifnα
Manufactured by R&D Systems
Sourced in United States
Recombinant IFNα is a laboratory product produced using recombinant DNA technology. It is a type of interferon alpha, a class of naturally occurring proteins involved in the body's immune response.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (4 mentions)
Mstud0173, by Merck Group (2 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (2 mentions)
Plus reagent, by Thermo Fisher Scientific (2 mentions)
Opti mem media, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Nigericin, by Merck Group (1 mentions)
Z ietd fmk, by R&D Systems (1 mentions)
Poly da dt, by Thermo Fisher Scientific (1 mentions)
Z devd fmk, by R&D Systems (1 mentions)
Dmem media, by Thermo Fisher Scientific (1 mentions)
Vx 765, by InvivoGen (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Ifn β, by R&D Systems (1 mentions)
Thioglycolate broth, by Merck Group (1 mentions)
5 protocols using recombinant ifnα
1
Myeloid Cell Manipulation in Slfn4-tdT Mice
2
Inducing Slfn4 Expression in Myeloid Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TG-elicited peritoneal myeloid cells were prepared from the Slfn4-tdT mice, as described previously.6 (link) Cells were treated with 100 nM Tamoxifen (Tx, dissolved in DMSO) for 24 hours to induce Cre recombinase activity and tdTomato expression ex vivo. The Hsa-MIR130b-3p miRNA mimic (50 nM, Applied Biological Materials, MCH01270) and the mimic negative control (MCH00000) were transfected into cells using Lipofectamine LTX with PLUS reagent (Thermo Fisher). The Mmu-Mir130b-3p miRNA antisense (CAGUGCAAUGAUGAAAGGGCAU) (10 nM, MSTUD0173, Sigma Aldrich), Slfn4 siRNA or the scrambled controls were transfected using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher) for 48 hours. To induce Slfn4 expression, the cells were treated with 800 U/mL recombinant IFNα (R&D, #12 125–1) for 24 hours or at different time points.
3
Induction of Inflammasome Activation in Human Salivary Gland Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human salivary gland epithelial cell line (HSG) was maintained in DMEM (Gibco™, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% FBS (Thermo Fisher Scientific). HSG cells were stimulated with 1,000 U/ml recombinant IFN-α (R&D Systems, Minneapolis, MN, USA) or 1,000 U/ml IFN-β (R&D Systems) in DMEM containing 10% FBS. For AIM2 inflammasome activation, HSG cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) reagents in Opti-MEM media (Thermo Fisher Scientific). After washing with Opti-MEM media, cells were stimulated with poly(dA:dT) 2 µg/ml (Invitrogen) for 6 h to 2 days in Opti-MEM media. For NLRP3 inflammasome, HSG cells were stimulated with Nigericin 10 µM (Sigma-Aldrich, St. Louis, MO, USA) for 12 h to 2 days in DMEM media (Thermo Fisher Scientific). Culture supernatants were collected, and cells were used for western blot or flow cytometry analysis. Caspase-1 inhibitors, VX765 (InvivoGen, San Diego, CA, USA), Caspase-3 inhibitor, Z-DEVD-FMK (R&D Systems), and Caspase-8 inhibitor, Z-IETD-FMK (R&D Systems) were pretreated for 1 h before poly(dA:dT) and Nigericin stimulation.
4
Isolation and Stimulation of Primary Mouse Peritoneal Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary mouse peritoneal macrophages (PMs) from Shp2fl/fl and LysMCre:Shp2fl/fl mice were elicited using thioglycolate broth (Sigma‐Aldrich) as previously described.33 , 34 The cells were seeded in six‐well plates and cultured in RPMI 1640 medium containing 10% fetal bovine serum at 37°C in a 5% CO2 atmosphere. After 4 hours cultivation, non‐adherent cells were removed. A total of 106 adherent PMs were stimulated with polyinosinic and polycytidylic acid (poly[I:C]), a synthetic analog of dsRNA (InvivoGen, San Diego, CA, USA), for 24 hours and subsequently inoculated with S aureus (multiplicity of infection [MOI], 10 CFU per cell) for the indicated time points. The cells were collected for mRNA or protein detection. For the IFN‐α pre‐treatment experiment, recombinant IFN‐α (1000 U/mL) (R&D systems, Minneapolis, MN, USA) was added to the cell culture 1 hour prior to 6 hours incubation with S aureus (MOI, 10). After stimulation, the supernatants were collected and stored at −80°C for cytokine measurement.
5
Immunomodulatory CMP-001 Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Unlabeled CMP-001, CMP-001 labeled with Cy5.5, methylated CMP-001 (mCMP-001, CMP-001 produced with methylated oligodeoxynucleotide that lacks TLR9 agonist activity), the G10 oligodeoxynucleotide (unmethylated, lyophilized form), and recombinant anti-Qβ were provided by Checkmate Pharmaceuticals (Cambridge, Massachusetts, USA). Other sources of anti-Qβ used in select experiments include humanized anti-Qβ antibody (cloned from EBV-transformed cells derived from a melanoma patient treated with CMP-001) and heat-inactivated (56°C, 30 min) anti-Qβ+ immune serum (from melanoma patients treated with CMP-001). For IgG+ bead experiments, human polyclonal IgG was purchased from BioXCell (#BE0092) and used to coat Pierce Protein L beads purchased from Thermo Fisher (#88849) as described in the manufacturer’s protocol. Recombinant IFN-α was purchased from R&D (#11 100–1). Cells were treated with the following concentrations of reagents: 10 μg/mL CMP-001, 10 μg/mL mCMP-001, 2.5 μg/mL G10 (note: CMP-001 is approximately four parts protein and one part DNA), 10 μg/mL recombinant anti-Qβ, 10 μg/mL humanized anti-Qβ, 1.25% heat-inactivated (56°C, 30 min) anti-Qβ+ immune serum, 10 μg/mL IgG+ protein L beads, and/or 1.792×104 U/mL Recombinant IFN-α.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!