Hybond Nylon membrane (Amersham) was pre-soaked in TE and a slot blot apparatus was assembled according to manufacturer’s instructions (Bio-Rad). Samples with matching RNase H1-digested controls were added to the blot in decreasing amounts, and nucleic acids were crosslinked to the membrane with a Strategene UV Stratalinker 1800 using the auto crosslink setting. Blots were blocked in milk, incubated with S9.6 (1:2,000) followed by mouse-HRP and imaged in a Bio-Rad Chemidoc MP. After imaging the R-loops, blots were stripped and re-probed using a dsDNA-specific antibody (Abcam ab27156) at 1:20,000. Intensities were measured with ImageJ,62 (link) and normalized intensity was obtained by dividing the S9.6 signal by the dsDNA signal.63 (link) A standard plot was made for each sample and antibody, and samples were chosen for analysis when their intensity was linear.
Hybond nylon membrane
Manufactured by Cytiva
Sourced in United Kingdom, Sweden
Hybond nylon membrane is a transfer membrane used in molecular biology techniques such as Northern blotting, Southern blotting, and Western blotting. It is made of nylon and serves as a support for the immobilization of nucleic acids or proteins, enabling their detection and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Slot blot apparatus, by Bio-Rad (2 mentions)
Ab27156, by Abcam (2 mentions)
Chemidoc mp, by Bio-Rad (2 mentions)
Dig easy hyb solution, by Roche (2 mentions)
Dig northern starter kit, by Roche (2 mentions)
Dig probe synthesis kit, by Roche (1 mentions)
α 32p dctp, by GE Healthcare (1 mentions)
Dot blot apparatus, by GE Healthcare (1 mentions)
Protran nitrocellulose membrane, by Cytiva (1 mentions)
Pcr dig probe synthesis kit, by Roche (1 mentions)
Dig labeled dntps, by Roche (1 mentions)
Dig luminescent detection kit, by Roche (1 mentions)
High prime dna labeling and detection starter kit 2, by Roche (1 mentions)
X ray film, by Kodak (1 mentions)
Criterion tbe urea polyacrylamide gel, by Bio-Rad (1 mentions)
Trans blot turbo transfer system, by Bio-Rad (1 mentions)
Perfection v700, by Epson (1 mentions)
Dig rna labelling kit sp6 t7, by Roche (1 mentions)
Biotinylated anti mouse igg vector ba 9200, by Vector Laboratories (1 mentions)
Streptavidin alkaline phosphatase vector sa 5100, by Vector Laboratories (1 mentions)
10 protocols using hybond nylon membrane
1
Quantification of RNA-DNA Hybrids by Slot Blot
2
Northern Blot Analysis of HSFAS Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot was conducted using a DIG Northern Starter kit (Roche, Basel, Switzerland) by Sangon Biotech (Shanghai) Co. Ltd (Shanghai, China). Briefly, DIG-labelled probes were synthesized using a PCR DIG Probe Synthesis kit (Roche), and the primer sequences for probe preparation are listed in
Table 2 .
Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
HSFAS | CTAGGCGAAAGAAATCGAAGTG | GCTAAGTTTGCCGAGTAAATCC |
3
Southern Blotting of Hpa I-Digested DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was digested with Hpa I and resolved on a 0.8% TAE Agarose gel at 100V for 5 h. Southern blotting was performed using a standard protocol. DNA was UV cross-linked to a Hybond nylon membrane (Amersham). The membrane was incubated in prehybridization buffer (6X SSPE (150 mM sodium chloride, 10 mM sodium phosphate and 1 mM EDTA), 1% Sarkosyl and 0.1% Bovine serum albumin, BSA) at 65°C for 1h. Following prehybridization, the membrane was incubated at 65°C overnight in hybridization buffer (6X SSPE, 1% Sarkosyl, IX Denhardt’s reagent containing 100 μg/ml salmon sperm DNA) and denatured probe (pGEM-Ex4.5 EcoRI-digested 500 bp DNA) that was labeled using α-32P dCTP (GE Healthcare Biosciences) and a random primer-labeling kit (Promega). The membrane was washed 2X in Buffer 1 (2X Saline-sodium citrate buffer, SSC, 1% SDS) at 65°C for 20 minutes and 2X in Buffer 2 (0.1 X SSC, 0.1% SDS) at 42°C for 20 minutes. The membrane was exposed to X-ray film (X-OMAT Blue XB, PerkinElmer Life Sciences) for a week and developed.
4
Quantifying miRNA-Target Interactions
5
Northern Blot Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot was conducted with DIG Northern Starter Kit (Roche, USA) by Sangon Biotech (Shanghai) Co., Ltd. (China). Briefly, DIG-labeled probes were synthesized using PCR DIG Probe Synthesis Kit (Roche, USA), primer sequences for probe preparation were:
GAPDH forward: 5′-ACTTTGGTATCGTGGAAGGACT-3′;
GAPDH reverse: 5′-TGCTGTAGCCAAATTCGTTGT-3′;
SPOCD1-AS forward: 5′-GCCAGGGAGACCATCTTTTGA-3′;
SPOCD1-AS reverse:5′- AGCTAAGCTGAACACAGTTCT-3′.
Total RNA (15 μg) was loaded onto 1% formaldehyde denatured gel electrophoresis, transferred to a Hybond nylon membrane (Amersham Biosciences, Sweden), and fixed at 80 °C for 2 h. The membrane was prehybridized in DIG Easy Hyb solution (Roche, USA) at 50 °C for 2 h and hybridized with DIG-labeled probes at 50 °C overnight. After washing with 2 × SSC at room temperature for 5 min and washing with 0.1 × SSC at 68 °C for 15 min, the membrane was blocked in Blocking solution for 1 h, incubated with antibody solution for 30 min, and detected using X-ray films.
GAPDH forward: 5′-ACTTTGGTATCGTGGAAGGACT-3′;
GAPDH reverse: 5′-TGCTGTAGCCAAATTCGTTGT-3′;
SPOCD1-AS forward: 5′-GCCAGGGAGACCATCTTTTGA-3′;
SPOCD1-AS reverse:5′- AGCTAAGCTGAACACAGTTCT-3′.
Total RNA (15 μg) was loaded onto 1% formaldehyde denatured gel electrophoresis, transferred to a Hybond nylon membrane (Amersham Biosciences, Sweden), and fixed at 80 °C for 2 h. The membrane was prehybridized in DIG Easy Hyb solution (Roche, USA) at 50 °C for 2 h and hybridized with DIG-labeled probes at 50 °C overnight. After washing with 2 × SSC at room temperature for 5 min and washing with 0.1 × SSC at 68 °C for 15 min, the membrane was blocked in Blocking solution for 1 h, incubated with antibody solution for 30 min, and detected using X-ray films.
6
Quantification of RNA-DNA Hybrids by Slot Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hybond Nylon membrane (Amersham) was pre-soaked in TE and a slot blot apparatus was assembled according to manufacturer’s instructions (Bio-Rad). Samples with matching RNase H1-digested controls were added to the blot in decreasing amounts, and nucleic acids were crosslinked to the membrane with a Strategene UV Stratalinker 1800 using the auto crosslink setting. Blots were blocked in milk, incubated with S9.6 (1:2,000) followed by mouse-HRP and imaged in a Bio-Rad Chemidoc MP. After imaging the R-loops, blots were stripped and re-probed using a dsDNA-specific antibody (Abcam ab27156) at 1:20,000. Intensities were measured with ImageJ,62 (link) and normalized intensity was obtained by dividing the S9.6 signal by the dsDNA signal.63 (link) A standard plot was made for each sample and antibody, and samples were chosen for analysis when their intensity was linear.
7
Generating Candida albicans tca17 Null Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
Table 1 lists the oligonucleotides and primers used for gene mutations and Southern blotting in this study. We generated a C. albicans tca17Δ/Δ null mutant (KO) and the knock-in reintegrant strain (KI) using the AHY940 wild-type strain and the CRISPR-Cas9 protocol developed by the Hernday laboratory (66 (link)). Successful transformations and correct strain construction were verified through PCR and Southern blotting of genomic DNA. For Southern blotting, 5 μg of genomic DNA was digested with BamHI and ScaI overnight and loaded onto a 1% agarose gel. Blotting was performed with a Hybond nylon membrane (Amersham) using standard protocols. The DNA probe was constructed by PCR using digoxigenin (DIG)-labeled dNTPs (Roche, Basel, Switzerland) and visualized with a DIG luminescent detection kit (Roche, Basel, Switzerland).
+ Expand
8
RNA Isolation and Northern Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from phenotypic and non-phenotypic larvae at 120 hpf was isolated using phenol:chloroform extraction. 2 μg of total RNA per lane was subjected to electrophoresis on a 0.8% agarose gel (with the addition of 7% formaldehyde) in 1xMOPS/1% formaldehyde buffer. RNA was then blotted to a Hybond-Nylon membrane (Amersham) and subsequently visualized using methylene blue staining. The detection of rRNA precursors was performed using the High Prime DNA Labeling and Detection Starter Kit II (Roche) kit, according to manufacturer’s protocol. The DNA probes targeted 5’ETS, ITS1, and ITS2 rRNA [61 (link)]. The signal was detected using an X-ray film (Kodak).
9
Detecting Virus-Derived Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus derived small RNAs were detected using Northern blotting. Forty micrograms total RNA were fractionated on 15% Criterion TBE-Urea polyacrylamide gel (Bio-Rad, Hercules, CA, USA) at 100V for 2 h. RNA was electrotransferred onto positively charged Hybond nylon membrane (Amersham, UK) using trans-Blot Turbo Transfer System (Bio-Rad, Hercules, CA, USA) at 25V for 30 min and immobilized by crosslinking to the membrane twice at 120,000 microjoules/cm2 using a Stratalinker UV crosslinker 1800 (Stratagene, La Jolla, CA, USA). RNAs probes for virus derived siRNAs detection were PCR amplified from AC2/AC3 region of each virus genome using primers listed on Table 1. In vitro transcription was performed using DIG RNA labelling kit SP6/T7 (Roche, Indianapolis, IN, USA) following manufacturer's instructions. The ensuing steps were performed as described by Kuria et al. (2017) . Blots were exposed to Amersham high-performance chemiluminescence film (GE Healthcare, Pittsburgh, PA, USA) for 15 min and processed on an automated developer (Konica Minolta-SRX-101A). The autoradiographs were scanned on Epson Perfection V700 photo scanned (Epson, CA, USA) and the signal quantified on image J.
10
Western Blot Analysis of BLV Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MAC-T, MAC-T BLV, and FLK cell culture supernatants were run in 12% polyacrylamide gels and transferred onto a Hybond + nylon membrane (Amersham Pharmacia, Sweden). After blocking with MTBS, the membrane was incubated 2 h with an anti-BLV-p24 monoclonal antibody (1:500) (a kind gift from Dr. Buehring, UCLA, Berkeley, USA) (Buehring et al., 1994) , washed 3 times for 15 min each with PBS-Tween and incubated with 0.5 µg/ml biotinylated anti-mouse IgG (Vector BA-9200) for 1 h. The membrane was washed with PBS-Tween and incubated with 1 µg/ml streptavidin-alkaline phosphatase (Vector SA-5100) for 30 min. After washing with PBS, BCIP/NBT (Color Development Substrate, Moss Inc.) was added for 10 min to develop the reaction and stopped by rinsing with tap water.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!