Ubi mcs 3flag cbh gcgfp ires puromycin vector

Manufactured by Genechem

Sourced in China

The Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin vector is a laboratory tool used for gene expression studies. It contains a ubiquitin promoter, a multiple cloning site, a 3xFLAG tag, a Cbh promoter, a green fluorescent protein (gcGFP) reporter, an internal ribosome entry site (IRES), and a puromycin resistance cassette. This vector can be used for recombinant protein expression and for the generation of stable cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Ubi mcs sv40 cherry ires neomycin vector, by Genechem (1 mentions) Pgph1 gfp neo vector, by GenePharma (1 mentions) Dharmafect transfection reagent, by Thermo Fisher Scientific (1 mentions) X tremegene hp dna transfection reagent, by Roche (1 mentions) Penter flag, by Charles River Laboratories (1 mentions) Lipofectamine 3000, by Genechem (1 mentions)

Close spelling variants of this product

Puromycin (88 citations) Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin (25 citations)

5 protocols using ubi mcs 3flag cbh gcgfp ires puromycin vector

Overexpression of ZNF300 via Lentivirus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human full-length ZNF300 CDS sequences were introduced into the BamHI/AgeI of GV569 (Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) vector (GENECHEM, Shanghai, China), and were transfected with lentivirus (Lv).

Zhou J.D., Zhang T.J., Xu Z.J., Deng Z.Q., Gu Y., Ma J.C., Wen X.M., Leng J.Y., Lin J., Chen S.N, & Qian J. (2020). Genome-wide methylation sequencing identifies progression-related epigenetic drivers in myelodysplastic syndromes. Cell Death & Disease, 11(11), 997.

+ Open protocol

+ Expand

Upregulation of miRNA-185 and STIM1 in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 6–10B and 5–8F cells in the logarithmic growth phase were transfected with the lentivirus carrying short hairpin RNA. The precursor of miRNA-185 was inserted into the Ubi-MCS-SV40-Cherry-IRES-neomycin vector (Genechem Co., CV622, Shanghai, China) to upregulate the expression of miRNA-185. STIM1 was inserted into the Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin vector (Genechem Co., GV492, Shanghai, China) to overexpress STIM1. The nonsense vector served as a negative control (NC).

Luo Y., Ye J., Deng Y., Huang Y., Liu X., He Q., Chen Y., Li Q., Lin Y., Liang R., Li Y., Wei J, & Zhang J. (2023). The miRNA-185-5p/STIM1 Axis Regulates the Invasiveness of Nasopharyngeal Carcinoma Cell Lines by Modulating EGFR Activation-Stimulated Switch from E- to N-Cadherin. Molecules, 28(2), 818.

+ Open protocol

+ Expand

Lentiviral Transduction of TSPAN5 and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lentiviruses, packaged with the Ubi‐MCS‐3FLAG‐CBh‐gcGFP‐IRES‐puromycin vector containing a full coding region of the TSPAN5 gene (NM_005723), were purchased from Shanghai GeneChem Co., Ltd (Zhangjiang Hi‐Tech Park, Shanghai, China). The lentiviruses, packaged with the pGPH1/GFP/Neo vector containing short hairpin RNA (shRNA) sequence targeting Tspan5 (sh1009:5′‐GCAGAAGATGTCATCAACACT‐3′) or scrambled control sequence (5′‐GTTCTCCGAACGTGTCACGT‐3′), were purchased from Shanghai GenePharma Co., Ltd (Zhangjiang Hi‐Tech Park). The viruses were transduced into HCC cell lines according to the manufacturer protocol. Puromycin (3–5 μg·mL⁻¹) was used for selection of stable cell lines. The lentiviruses used for in vivo imaging experiments were packaged with the pLenti‐CBh‐3FLAG‐luc2‐tCMV‐tdTomato‐F2A‐blasticidin vector and purchased from Shanghai Obio Technology Co., Ltd (Pudong New Area, Shanghai, China). Blasticidin (10 μg·mL⁻¹) was used for selection of stable cells. All functional experiments were conducted within 2 weeks following the lentiviral infection.

Xie Q., Guo H., He P., Deng H., Gao Y., Dong N., Niu W., Liu T., Li M., Wang S., Wu Y, & Li J. (2021). Tspan5 promotes epithelial–mesenchymal transition and tumour metastasis of hepatocellular carcinoma by activating Notch signalling. Molecular Oncology, 15(11), 3184-3202.

+ Open protocol

+ Expand

Manipulation of SPOCD1-AS and G3BP1 in cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

SPOCD1-AS overexpression lentivirus (Ubi-MCS-SV40-EGFP-IRES-puromycin), SPOCD1-AS shRNA lentiviruses (hU6-MCS-Ubiquitin-EGFP-IRES-puromycin) and lentiviral construct expressing Luciferase (Ubi-MCS-firefly_Luciferase-IRES-Puromycin) were synthesized by Genechem (China) and transduced into cells according to instructions. Flag-tagged full length human G3BP1, G3BP1 RNA recognition motif (RRM) truncation, and the F380L/F382L mutants of G3BP1 constructs were cloned into a Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin vector (Genechem, China). Transfection of plasmids was performed using X-treme GENE HP DNA Transfection Reagent (Roche, China). G3BP1 inhibitory siRNAs and negative controls were synthesized by Genepharma (China). Transfection of siRNAs was performed using DharmaFECT Transfection Reagents (Thermo, USA).
The target sequences of shRNAs and siRNAs were listed in Table S4. The sequences of primers used for plasmid construction were listed in Table S5. All constructs were confirmed by DNA sequencing.

Wang C., Wang J., Shen X., Li M., Yue Y., Cheng X., Lu W., Wang X, & Xie X. (2021). LncRNA SPOCD1-AS from ovarian cancer extracellular vesicles remodels mesothelial cells to promote peritoneal metastasis via interacting with G3BP1. Journal of Experimental & Clinical Cancer Research : CR, 40, 101.

+ Open protocol

+ Expand

Manipulating PBX2 and HOXA6 in GC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-PCR amplification was carried out to prepare normal human cDNA with related to the full-length PBX2 or HOXA6. Thereafter, the PCR products obtained were further cloned to pENTER-FLAG or pENTER-HA mammalian expression vector (Vector, Vigene Biosciences, Rockville, MD, USA). Next, stable GC cell lines with ectopic HOXA6 or PBX2 expression were established using Lipofectamine TM 3000.
Lentiviruses expressing EGFP/HOXA6 (LV-HOXA6) were synthesized by GeneChem (Shanghai, China) by the use of Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin vector, whereas the corresponding empty vector served as internal reference (Shanghai GeneChem Co, Ltd, China).
The double-stranded oligonucleotides that encoded human HOXA6-vshRNA (NM_024014: HOXA6 shRNA 2: CCGGAGGAAAACAAGCUCAUCAATCAAGAGUUGAUGAGCUUGUUUUGGUTTTTTG) or PBX2-vshRNA (NM_002586: PBX2 shRNA 2: CCGGCAUCGAACACUCGGACUAUUCAAGAGGUAGCUUGUGAGCCUGAUAUUUUG) were annealed and inserted into the U6-MCS-Ubiquitin-Cherry-IRES-puromycin short hairpin RNA (shRNA) expression vector. The selective overexpression or knockdown cells were applied in later analysis.

Lin J., Zhu H., Hong L., Tang W., Wang J., Hu H., Wu X., Chen Y., Liu G., Yang Q., Li J., Wang Y., Lin Z., Xiao Y., Dai W., Huang M., Li G., Li A., Wang J., Xiang L, & Liu S. (2021). Coexpression of HOXA6 and PBX2 promotes metastasis in gastric cancer. Aging (Albany NY), 13(5), 6606-6624.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!