Rnaprep mini kit

Total RNA was extracted from the patient’s tissue (RNAprep Mini kit, Qiagen), and 500 ng RNA was subjected to reverse transcription using a reverse transcription kit (Bioneer). Real-time quantitative PCR amplification was performed with SYBR Green (ABI) in a real-time system (ABI, USA). Human-specific PCR primers (Bioneer) were used to analyze the expression of the following genes: PDGFRA and GAPDH. The mRNA levels of the specific genes were calculated as ΔΔCt and normalized to those of GAPDH.

Total RNA was extracted from Twist1-transfected or untransfected cells (RNAprep Mini kit, Qiagen), and 500 ng RNA was subjected to reverse transcription using MuLV reverse transcriptase (NEB). Real-time quantitative PCR amplification was performed with a two-step TaqMan Probe Master Mix (Roche, Germany) in a real-time system (ABI, USA). Human-specific TaqMan PCR primers and probes (Roche, Germany) were used to analyze expression of the following genes: Twist1, E-cadherin, β-catenin, vimentin, AKT, GSK-3β, IκBα, p65, CD44, CD166, and β-actin (Supplement Table S1). mRNA levels of specific genes were calculated as ΔΔCt and normalized to β-actin.

Total RNA was extracted from cells transfected with CCL7 or GFP (RNAprep Mini kit, Qiagen, Venlo, Netherlands) and 500 ng of RNA was subjected to reverse transcription using MuLV reverse transcriptase (NEB, UK). Real-time quantitative PCR amplification was performed with two-step TaqMan Probe Master Mix (Roche, Indianapolis, IN, USA) or SYBR green PCR Mater Mix (Applied Biosystems, Carlsbad, CA, USA) on an ABI real-time thermocycler (Applied Biosystems, Carlsbad, CA, USA). Human-specific TaqMan PCR primer set were purchased from Applied Biosystems. CCL7 Hs00171147_m1 and β-actin Hs01060665_g1 were used in this study. The following genes were evaluated: CCL7 gene (upstream primer: 5′-accaccagtagccactgtcc -3′; downstream primer: 5′- gaggagcatcccacagtttt - 3′); CCR3 gene (upstream primer: 5′- gacctgctcttcctcgtcac-3′, downstream primer: 5′- agcagagggagaacgagaca-3′); E-cadherin gene (upstream primer: 5′-ggtcgacaaaggacagccta-3′, downstream primer: 5′- ggcgtagaccaagaaatgga-3′); vimentin gene (upstream primer: 5′- ctcctccccctgtcacatac-3′, downstream primer: 5′-tgattggcatcaggaccgtt-3′); Gapdh gene (upstream primer: 5′-aatcccatcaccatcttcca- 3′, downstream primer: 5′-tggactccacgacgtactca-3′). The mRNA level of each gene was quantified using the ΔΔCt method and normalized to that of β-actin.