Libraries were constructed according to the standard 10x Genomics protocol (Single Cell 3′ Reagent Kits v2 User Guide) with modifications to accommodate Nanopore long-read sequencing. For root tip, nucleus suspension from the previous step (~ 5000 nuclei) were loaded onto the 10x Genomics ChIP, and libraries were made using a 10x Chromium Single Cell 3′ Solution V2 kit. For endosperm, ~ 10,000 nuclei were loaded and subjected to library construction. To obtain full-length cDNA, we extend the elongation time during cDNA amplification from the standard 1 min to 2 min. Half of the cDNA template was used to construct Illumina library according to the manufacturer’s instruction and sequenced with Illumina NavoSeq (Read1:28 bases + Read2:150 bases); the other half of the template was used to make Nanopore library using the Oxford Nanopore LSK-109 kit and sequenced on a MinION flow cell (R9.4.1).
Navoseq
Manufactured by Illumina
NavoSeq is a next-generation sequencing instrument designed for high-throughput DNA and RNA sequencing. It utilizes advanced fluidics and optics to enable rapid and accurate sequencing of genetic samples.
Automatically generated - may contain errors
Lab products found in correlation
Ampure xp bead, by Beckman Coulter (3 mentions)
Kapa hifi hotstart readymix pcr kit, by Roche (2 mentions)
Truseq universal primer, by Illumina (2 mentions)
Tnt sp6 coupled wheat germ extract system, by Promega (2 mentions)
Countess, by Thermo Fisher Scientific (1 mentions)
Haemocytometer, by Thermo Fisher Scientific (1 mentions)
Magne halotag beads, by Promega (1 mentions)
Nextflex rapid dna seq kit, by PerkinElmer (1 mentions)
9 protocols using navoseq
1
Single-cell multi-omics library prep
2
Grapevine Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from leave tissues of Cabernet Sauvignon grapevines using a one-step plant DNA extraction reagent (Bio Teke, Beijing, China). The DNA was dissolved in 50 μL of Tris-EDTA buffer. DNA-seq binding assays were performed as described by a previous study [53 (link)]. Sequencing was performed on an Illumina NavoSeq. Reads were mapped to the grape reference genome sequence using BOWTIE2 and annotated in comparison with the V2.1 version (http://genomes.cribi.unipd.it/grape/ ). Peak calling was conducted using Macs2. Association of DAP-seq peaks located upstream or downstream of the transcription start site within 2 kb were analyzed using Homer, according to the General Feature Format (GFF) files. Gene function annotation was blasted from NT, NR, Swissprot, and Pfam databases. FASTA sequences were obtained using BEDTools for motif analysis and motif discovery was performed using MEME-Chip suite (http://meme-suite.org/tools/meme-chip ).
3
Protein-Bound DNA Enrichment Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein-bound beads were incubated with 50 ng of adaptor-ligated gDNA fragments on a rotator for 1 h at room temperature in 50 μl of wash/bind buffer. Beads were washed three times using the same wash buffer to remove unbound DNA fragments. The HaloTag beads were resuspended in 30 μl of elution buffer and heated to 98 °C for 10 min to denature the protein and release the bound DNA fragments into solution. The supernatant was transferred to a new well, and 25 μl were used in a 50 μl PCR employing the KAPA HiFi HotStart ReadyMixPCR Kit (Roche, Basel, Switzerland) for 10 cycles. PCR primers consisted of the full-length Illumina TruSeq Universal primer (5'–AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT–3') and an Illumina TruSeq Index primer (5'–CAAGCAGAAGACGGCATACGAGAT-NNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT–3'), where NNNNNN represents the 6 bp sequence index used for sample identification. The PCR product was purified and selected using AMPure XP beads (Beckman), as previously described, and resuspended in 20 μl of nuclease-free water. DNA concentrations were determined using a Qubit (Life Technologies, Burlington, Ontario, Canada). Eluted DNA fragments were sequenced on an Illumina NavoSeq. Negative control mock DAP-seq libraries were prepared without the addition of protein to the beads.
4
Single-cell RNA sequencing protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the resection, tissue specimens were rapidly processed for single-cell RNA sequencing.
Single-cell suspensions were prepared according to the protocol of Chromium Single Cell 3′ Solution (V2 chemistry). All specimens were washed two times with cold 1× phosphate-buffered saline (PBS). Haemocytometer (Thermo Fisher Scientific) was used to evaluate cell viability rates. Then, we used Countess (Thermo Fisher Scientific) to count the concentration of single-cell suspension, and adjust the concentration to 1000 cells/μl. Samples that were lower than the required cell concentration defined in the user guide (i.e., <400 cells/µl) were pelleted and re-suspended in a reduced volume; and then the concentration of the new solution was counted again. Finally, the cells of the sample were loaded, and the libraries were constructed using a Chromium Single-Cell Kit (version 2). Single-cell libraries were submitted to 150 bp paired-end sequencing on the Illumina NavoSeq platform.
Single-cell suspensions were prepared according to the protocol of Chromium Single Cell 3′ Solution (V2 chemistry). All specimens were washed two times with cold 1× phosphate-buffered saline (PBS). Haemocytometer (Thermo Fisher Scientific) was used to evaluate cell viability rates. Then, we used Countess (Thermo Fisher Scientific) to count the concentration of single-cell suspension, and adjust the concentration to 1000 cells/μl. Samples that were lower than the required cell concentration defined in the user guide (i.e., <400 cells/µl) were pelleted and re-suspended in a reduced volume; and then the concentration of the new solution was counted again. Finally, the cells of the sample were loaded, and the libraries were constructed using a Chromium Single-Cell Kit (version 2). Single-cell libraries were submitted to 150 bp paired-end sequencing on the Illumina NavoSeq platform.
5
HaloTag-mediated DNA Enrichment and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein-bound beads were incubated with 50 ng of adapter-ligated gDNA fragments on a rotator for 1 h at room temperature in 50 μL wash/bind buffer. Beads were washed three times using the same wash buffer to remove unbound DNA fragments. The HaloTag beads were resuspended in 30 μL of elution buffer and heated to 98°C for 10 min to denature the protein and release the bound DNA fragments into solution. The supernatant was transferred to a new well, and 25 μL were used in a 50 μL PCR employing the KAPA HiFi HotStart ReadyMixPCR Kit (Roche, Basel, Switzerland) for 10 cycles. PCR primers consisted of the full-length Illumina TruSeq Universal primer (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACA CGACGCTCTTCCGATCT-3′) and an Illumina TruSeq Index primer (5′-CAAGCAGAAGACGGCATACGAGATNNNNNNGT GACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′) where NNNNNN represents the 6 bp sequence index used for sample identification. The PCR product was purified and selected using AMPure XP beads (Beckman) as described above, and resuspended in 20 μL nuclease-free water. DNA concentrations were determined using a Qubit (Life Technologies, Burlington, ON, Canada). Eluted DNA fragments were sequenced on an Illumina NavoSeq. Negative control mock DAP-seq libraries were prepared without the addition of protein to the beads.
6
Genome-wide MabHLH28 Binding Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DAP-Seq was conducted by the procedure previously described by Yang et al. [62 (link)]. The gDNA was extracted from banana fruit to construct the sequencing library. The coding sequence of MabHLH28 was combined into thepFN19K vector to yield the affinity-purified Halo-MabHLH28 protein. Then, the Halo-MabHLH28 protein was incubated with the gDNA library. The bound DNA fragments were sequenced on an Illumina NavoSeq, and the reads were mapped to the genome sequence of Musa. MEME-ChIP was used to discover the core binding motif ofMabHLH28. The candidate target genes were analysed using the GO and KEGG pathway prediction.
7
GmRAV Transcription Factor Binding Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DAP-seq was carried out as previously described with minor modifications (O'Malley et al., 2016) . gDNA was extracted from young soybean leaves, fragmented, purified using AMPure XP beads (Beckman Coulter, Inc., Indianoplis, IN, USA). Libraries were constructed using the NEXTFLEX Rapid DNA-Seq Kit (PerkinElmer, Inc., Austin, TX, USA) according to the instruction manual. The coding sequence of GmRAV was cloned into a pFN19K HaloTag T7 SP6 Flexi expression vector. Halo-GmRAV fusion protein was expressed using the TNT SP6 Coupled Wheat Germ Extract System (Promega) following the manufacturer's specifications for expression. Expressed proteins were directly captured using Magne Halo Tag Beads (Promega). The protein-bound beads were incubated with adaptor-ligated gDNA fragments, washed and eluted. Eluted DNA fragments were PCR amplified and sequenced on an Illumina NavoSeq. Reads were mapped to the phytozome genome for Glycine max (Wm82.a2.v1). DAP-seq peaks were called using Macs2 (Zhang et al., 2008) . Association of DAP-seq peaks located upstream or downstream of the transcription start site within 2 kb were analyzed using HOMER (Heinz et al., 2010) , based on the general feature format files. Motif discovery was performed using Genome-wide Binding Event Finding and Motif Discovery (Guo et al., 2012) to identify the motifs to which GmRAV bound.
8
Single-cell 3' RNA-seq with Nanopore
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Libraries were constructed according to the standard 10x Genomics protocol (Single Cell 3' Reagent Kits v2 User Guide) with modifications to accommodate Nanopore long-read sequencing.
Briefly, nuclei suspension from the previous step (~5000 nuclei) were loaded onto the 10x Genomics ChIP, and libraries were made using a 10x Chromium Single Cell 3' Solution V2 kit.
To obtain full-length cDNA, we extend the elongation time during cDNA amplification from the standard 1 min to 2 minutes. Half of the cDNA template was used to construct Illumina library (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
The copyright holder for this preprint this version posted November 26, 2020. ; https://doi.org/10.1101/2020.11.25.397919 doi: bioRxiv preprint 10 according to the manufacturer's instruction and sequenced with Illumina NavoSeq (Read1:28 bases + Read2:150 bases); the other half of the template was used to make Nanopore library using the Oxford Nanopore LSK-109 kit and sequenced on a MinION flow cell (R9.4.1).
Briefly, nuclei suspension from the previous step (~5000 nuclei) were loaded onto the 10x Genomics ChIP, and libraries were made using a 10x Chromium Single Cell 3' Solution V2 kit.
To obtain full-length cDNA, we extend the elongation time during cDNA amplification from the standard 1 min to 2 minutes. Half of the cDNA template was used to construct Illumina library (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
The copyright holder for this preprint this version posted November 26, 2020. ; https://doi.org/10.1101/2020.11.25.397919 doi: bioRxiv preprint 10 according to the manufacturer's instruction and sequenced with Illumina NavoSeq (Read1:28 bases + Read2:150 bases); the other half of the template was used to make Nanopore library using the Oxford Nanopore LSK-109 kit and sequenced on a MinION flow cell (R9.4.1).
9
Transcription Factor Binding Profiling by DAP-seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five μg P. tomentosa genomic DNA (gRNA) was fragmented to an average of 200 bp and used for DNA-seq library construction. PsiYAB11 protein was expressed using the TNT SP6 Coupled Wheat Germ Extract System (Promega). The protein-bound beads were incubated with 50 ng of adaptor-ligated gDNA fragments on a rotator for 1 h at room temperature. After denature the protein and release the bound DNA fragments, eluted DNA fragments were sequenced on an Illumina NavoSeq. Reads were mapped to P. trichocarpa reference genome v3.0 using HISAT2 (Kim et al., 2015) . DAP-seq peaks, which stand for the transcription factor binding sites, were called by MACS2 coupled with the IDR pipeline (Zhang et al., 2008) . Motif discovery was performed using MEME-Chip suite 5.0.5 (Machanick et (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
al., 2011) (Supplemental Methods S8).
al., 2011) (Supplemental Methods S8).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!