Rnaeasy kit

Total RNAs were extracted with the TRIZOL (Life, USA) and RNAeasy kit (Tiangen, China). The first strand of cDNA was synthesized by iScript cDNA Synthesis kit (Takara, Japan) according to the instructions for qPCR. The mixed cDNA samples were used for PCR reaction with SYBR Green (Life, USA) in 20 mol/L volume. The primer used are listed s in Table 3. The reaction was performed at 95°C for 10min, followed by denaturation at 94°C for 15 s, annealing at 54°C for 30 s and extension at 72°C for 40 s, with a Real‐Time System (Applied Biosystems, USA).

Different Hydrogels contained cells and ADSCs were collected respectively after 21 days culture. Total cellular RNA was isolated using Trizol reagent (Hyclone, Logan, Utah, USA). Total RNA was extracted using the RNA Easy kit (Tiangen Biotech Co. Ltd., Beijing, China) according to the manufacturer’s instructions. PCR was performed with Taq DNA Polymerase (Takara, Tokyo, Japan) using a pair of primers for canine HIF-1αwith an expected product length of 582 bp, (forward primer: HIF-1α-F 5′-TCTGAGGGGACGCGAGGAT-3′ reverse primer: HIF-1α-R: 3′-CCTGGTCCACAGAAGATGTTT-5′). Canine glyceraldehyde-3-phosphate dehydrogenase (dGAPDH) was amplified as an internal control for RNA loading (Gen- Bank accession number: L-23961; forward primer: GAPDH-F: 5′ GATGCTGGTGCTGAGTATGT 3′, reverse primer: GAPDH-R: 3′ GAAGCCGTAGCACCTC 5′, expected product length: 252 bp). PCR products were separated in 1.5% agarose gel.