Crrna

Manufactured by Merck Group

Sourced in United States

CrRNA is a component of the CRISPR-Cas9 gene editing system. It serves as a guide RNA that directs the Cas9 enzyme to a specific DNA sequence for targeted editing. CrRNA can be designed to target different genomic regions and is used in various research and biotechnology applications.

Automatically generated - may contain errors

Lab products found in correlation

Tracrrna, by Merck Group (7 mentions) Nepa21 electroporator, by Nepa Gene (3 mentions) Genotyping primers, by Ajinomoto Group (3 mentions) Cas9 nuclease solution, by Thermo Fisher Scientific (3 mentions) Cas9 protein, by Thermo Fisher Scientific (1 mentions) Engen spy cas9 nls protein, by New England Biolabs (1 mentions) Tracrrna05n 5nmol, by Merck Group (1 mentions) Femtojet 4i, by Eppendorf (1 mentions) Cas9 protein, by Merck Group (1 mentions)

7 protocols using crrna

Generation of Ccdc183 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ccdc183 KO mice were generated as previously described (Abbasi et al., 2018 (link)). We designed two gRNAs to recognize exon 1 and exon 14 to remove the whole coding sequence (Fig. S1A). The crRNA sequences used in this study were 5′-AGGCACAGATAACGGAGCTA-3′ and 5′- ACCATAGTTACGTCCCTTCG-3′. Synthesized crRNAs (Merck), tracrRNA (Merck) and CAS9 protein (Thermo Fisher Scientific) were incubated to make the CAS9 ribonucleoprotein (RNP) complex. The obtained complex was electroporated into fertilized eggs using a NEPA21 electroporator (Nepa Gene). Of the 120 fertilized eggs that had been electroporated, 112 eggs were transplanted into the oviducts of pseudopregnant females. A total of 32 potential founder mice (F0) were born, and 18 pups possessed mutations. Ccdc183 KO mice were maintained by sibling crosses. Male mice over 12 weeks of age were used for the studies.
Frozen spermatozoa from Ccdc183 KO males (B6D2-Ccdc183^em1Osb) were deposited at both the Riken BioResource Center, Ibaraki, Japan (RBRC number: 11642) and the Center for Animal Resources and Development (CARD), Kumamoto University, Kumamoto, Japan (CARD ID: 3199). Ccdc183 KO mice are available through these centers.

Shimada K, & Ikawa M. (2023). CCDC183 is essential for cytoplasmic invagination around the flagellum during spermiogenesis and male fertility. Development (Cambridge, England), 150(21), dev201724.

+ Open protocol

+ Expand

CRISPR-Cas9 Editing in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target sequences were ordered as crRNAs (Merck) based on previously published sequences (Wu et al., 2018) (Supplementary Table 1) and co-injected alongside tracrRNA (Merck) in equimolar ratios and EnGen®Spy Cas9 NLS protein (NEB) into 1-cell zebrafish embryos.

Chen Y., Jiang Z., Fisher K.H., Kim H.R., Evans P.C., & Wilkinson R.N. (2021). Blood flow coordinates collective endothelial cell migration during vascular plexus formation and promotes angiogenic sprout regression via vegfr3/flt4.

+ Open protocol

+ Expand

CRISPR-Cas9 Zygote Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Superovulated B6D2F1 females were mated with B6D2F1 males, and eggs were collected from the oviduct (21 h after hCG injection). SpCas9 and SpCas9-NG were prepared as previously described^{7 (link)} and incubated with synthesized crRNA (Sigma–Aldrich, St. Louis, MO, USA) and tracrRNA (#TRA crRNA05N-5NMOL, Sigma–Aldrich) at 37 °C for 5 min to make a gRNA/Cas9 ribonucleoprotein complex (40 ng/µL crRNA:tracrRNA, 100 ng/µL Cas9). crRNA and tracrRNA sequence are listed in Supplementary Data 1. The obtained complex was electroporated into zygotes using a super electroporator NEPA21 as previously described⁴⁸. The eggs were cultivated in KSOM^{49 (link)} for 4 days until they reached to the late blastocyst stage. Blastocysts were then collected in test tubes (8–10 eggs/ tube) and incubated in lysis buffer at 37 °C for 2 h.

Oura S., Noda T., Morimura N., Hitoshi S., Nishimasu H., Nagai Y., Nureki O, & Ikawa M. (2021). Precise CAG repeat contraction in a Huntington’s Disease mouse model is enabled by gene editing with SpCas9-NG. Communications Biology, 4, 771.

+ Open protocol

+ Expand

Generation of ΔRING-Trim41 Mutant Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ΔRING-Trim41 mice were generated by microinjection described previously [49 (link)]. First, a gRNA solution was prepared by annealing two tra crRNAs (Sigma-Aldrich, St. Louis, MO, USA) and crRNA (Sigma-Aldrich). The target genomic sequences are listed in S1 Table Then, the gRNA solution and Cas9 nuclease solution (Thermo Fisher Scientific, Waltham, MA, USA) were mixed: 40 ng/μL gRNA each and 108 ng/μL Cas9 nucleases. The obtained complex was then microinjected into fertilized eggs (B6D2F1) using a programmable microinjector (FemtoJet 4i, Eppendorf, Hamburg, Germany). The microinjected eggs were then transplanted into the oviduct ampulla of pseudopregnant mice (ICR) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with the desired mutation were maintained by sibling matings. The genotyping primers (GeneDesign) are listed in S1 Table The mutant mouse line is available from Riken BRC (#11041) and CARD (#2948).

Oura S., Hino T., Satoh T., Noda T., Koyano T., Isotani A., Matsuyama M., Akira S., Ishiguro K.I, & Ikawa M. (2022). Trim41 is required to regulate chromosome axis protein dynamics and meiosis in male mice. PLoS Genetics, 18(6), e1010241.

+ Open protocol

+ Expand

Generation of Kctd19 Knockout Mice

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kctd19 deletion mice and Kctd19-ΔPOZ/TAZ mice were generated by electroporation described previously [43 (link),44 (link)]. Briefly, a gRNA solution was prepared by annealing two tra crRNAs (Sigma-Aldrich, St. Louis, MO, USA) and crRNA (Sigma-Aldrich). The target genomic sequences are listed in S1 Table. Then, the gRNA solution and Cas9 nuclease solution (Thermo Fisher Scientific, Waltham, MA, USA) were mixed. The final concentrations of gRNA and Cas9 were as follows: for pronuclear injection, 20 ng/μL gRNA, and 100 ng/μL Cas9 nucleases. The obtained complex was electroporated into fertilized eggs using a NEPA21 electroporator (NEPA GENE, Chiba, Japan). The electroporated eggs were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 9612 bp deletion and a 2172 bp deletion were maintained by sibling mating and used for the phenotype analysis of Kctd19 deletion and Kctd19-ΔPOZ, respectively. The genotyping primers (GeneDesign, Osaka, Japan) and amplification conditions are available in S1 Table.

Oura S., Koyano T., Kodera C., Horisawa-Takada Y., Matsuyama M., Ishiguro K.I, & Ikawa M. (2021). KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. PLoS Genetics, 17(5), e1009412.

+ Open protocol

+ Expand

CRISPR-Cas9 Genome Editing of Autophagy Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The online web tool CHOPCHOP was used to design a specific guide RNA in exon 3 of atg5 and exon 2 atg16l1. Purified crRNA, Cas9 protein, and tracrRNA were purchased from Sigma-Aldrich. We used the following crRNA sequences, where the PAM site is indicated in brackets: atg5: TCAGGTAACTGACCCGTGGG(AGG) atg16l1: TTTGTGGAAGCGTCACGTTG(TGG). Each embryo was injected with 1 nl of 16.6 µM crRNA, tracrRNA, and Cas9 protein mixture at the one-cell stage. As controls, only Cas9 + tracrRNA were without crRNA.

Prajsnar T.K., Serba J.J., Dekker B.M., Gibson J.F., Masud S., Fleming A., Johnston S.A., Renshaw S.A, & Meijer A.H. (2020). The autophagic response to Staphylococcus aureus provides an intracellular niche in neutrophils. Autophagy, 17(4), 888-902.

+ Open protocol

+ Expand

Generation of Kctd19 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kctd19 deletion mice and Kctd19-ΔPOZ/TAZ mice were generated by electroporation described previously (42, 43) . Briefly, a gRNA solution was prepared by annealing two tra crRNAs (Sigma-Aldrich, St. Louis, MO, USA) and crRNA (Sigma-Aldrich). The target genomic sequences are listed in Table S1. Then, the gRNA solution and Cas9 nuclease solution (Thermo Fisher Scientific, Waltham, MA, USA) were mixed. The final concentrations of gRNA and Cas9 were as follows: for pronuclear injection, 20 ng/µL gRNA, and 100 ng/µL Cas9 nucleases. The obtained complex was electroporated into fertilized eggs using a NEPA21 electroporator (NEPA GENE, Chiba, Japan). The electroporated eggs were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 9612 bp deletion and a 2172 bp deletion were maintained by sibling mating and used for the phenotype analysis of Kctd19 deletion and Kctd19-ΔPOZ, respectively. The genotyping primers (GeneDesign, Osaka, Japan) and amplification conditions are available in Table S1.

Oura S., Koyano T., Kodera C., Takada-Horisawa Y., Matsuyama M., Ishiguro K., & Ikawa M. (2021). KCTD19 associates with ZFP541 and HDAC1 and is required for meiotic exit in male mice.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!