The transcript levels of non-receptor genes were quantified by real-time qPCR performed in a QuantStudio 3 Real-Time PCR System (Applied Biosystems). Gene-specific primers for PxAPN5, PxAPN6, and PxABCC1 were used (Additional file 1 : Table S1) in qPCR reactions with 2.5×SYBR Green MasterMix Kit (TIANGEN) as described in detail elsewhere [22 (link), 27 (link)]. The qPCR program consisted of an original denaturation step for 6 min at 95 °C, subsequently, 40 cycles of denaturation for 30 s at 95 °C, annealing for 30 s at 53 °C for PxAPN6, 55 °C for PxABCC1 and PxAPN5, followed by an extension for 35 s at 72 °C. Relative quantification was calculated by utilizing the 2−ΔΔCt method and standardized to the ribosomal protein L32 gene (GenBank accession no. AB180441). Three biological repetitions and four technical replicates were performed for each sample.
Sybr green master mix kit
Manufactured by Tiangen Biotech
Sourced in China
The SYBR Green master mix kit is a reagent solution designed for real-time PCR applications. It contains the necessary components, including SYBR Green I dye, required for the detection and quantification of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (5 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Primer premier 5, by Premier Biosoft (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Rna pre pure cell bacteria kit, by Tiangen Biotech (1 mentions)
Lc480, by Roche (1 mentions)
Fastquant rt kit, by Tiangen Biotech (1 mentions)
Cfx96 qpcr machine, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Transgene (1 mentions)
Trizol total rna reagent, by Thermo Fisher Scientific (1 mentions)
Polyvinylidene uoride membrane, by Merck Group (1 mentions)
Sds page, by Solarbio (1 mentions)
Total rna small amount extraction kit, by Corning (1 mentions)
Gapdh, by Proteintech (1 mentions)
10 protocols using sybr green master mix kit
1
Quantification of Resistance Gene Expression
2
Quantitative PCR Analysis of PxAPN Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene transcript levels were quantified by real-time quantitative PCR (qPCR) detection processed in the QuantStudio 3 Real-Time PCR System (Applied Biosystems)27 (link). Briefly, gene-specific primers of the PxAPN genes (Supplementary Table 6 ) with high amplification efficiencies (95–100%) were selected and used in qPCR reactions with 2.5× SYBR Green MasterMix Kit (TIANGEN) following the manufacturer’s instructions. The qPCR program included an initial denaturation at 94 °C for 6 min, followed by 40 cycles of amplification at 94 °C for 30 s, 50–60 °C (depending on the primers) for 30 s, and 72 °C for 35 s. Relative expression levels were calculated using the 2−ΔΔCt method and normalized to the ribosomal protein L32 (RPL32) gene (GenBank accession no. AB180441 ).
3
Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene‐specific primers of PxMettl3, PxMettl14, PxWTAP, PxSpenito, PxVirlizer, PxFlacc, PxHakai, and PxJHE gene used for real‐time quantitative PCR (qPCR) analysis were designed using the Primer Premier 5.0 software (Premier Biosoft) (Table S1 , Supporting Information). The 2.5 × SYBR Green MasterMix Kit (TIANGEN) was used to detect the transcript levels of these genes using a QuantStudio 3 Real‐Time PCR System (Applied Biosystems), and the procedure involved initial denaturation at 94 °C for 3 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. The 2−ΔΔCt method was used to calculate the relative expression of the target gene, and the relative expression of the target gene was normalized to the ribosomal protein L32 (RPL32) gene (GenBank accession no. AB180441) as before.[37 (link)
] Each sample was performed with three biological and four technical replicates.
] Each sample was performed with three biological and four technical replicates.
4
Quantifying TMED3 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen tissues or cell lines using the TRIzol reagent (Takara, Dalian, China), according to the manufacturer’s instructions. The primers used for amplifying TMED3 and the endogenous control β-actin were synthesized by Sangon Biotech (Shanghai, China). qRT-PCR was performed using the SYBR Green master mix kit (TianGen Biotech, Beijing, China), according to the manufacturer’s instructions. The fold change in the expression of target genes was calculated by the 2−ΔΔCT method.
5
Fluorescence Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The fluorescence analysis was performed as described previously32 . Briefly, total RNA was extracted from tumours using an RNA pre-pure Cell/Bacteria Kit (Tiangen Biotech, Beijing, China) and reverse-transcribed into cDNA using a FastQuant RT Kit (Tiangen Biotech, China) according to the manufacturer’s instructions. Real-time PCR for the indicated genes was detected on an LC480 (Roche, Basel, Germany) with a SYBR Green Master Mix Kit (Tiangen Biotech, Beijing, China) following the manufacturer’s instructions. The primers used in the experiments are described in Table S1 . β-actin mRNA served as an internal reference, and the results were normalized and are shown as the ratio to the control group.
6
Quantitative Real-Time PCR of Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of target genes were quantified using the QuantStudio 3 Real-Time PCR System (Applied Biosystems). On the basis of the obtained coding sequences of BtUCA and BtAtzF, specific primer pairs of both genes (table S6) were designed by Primer Premier 5.0. The amplification specificity of primer pairs was confirmed by the occurrence of a single peak in a melting curve following qPCR. The amplification efficiencies of primers were 90% to 110%. Each primer pair with proper amplification specificity and efficiency was used in qPCRs with 2.5 × SYBR Green MasterMix Kit (TIANGEN). Three-step qPCR programs were applied. Besides annealing temperatures (BtUCA, 59°C; BtAtzF, 58°C), other parameters of qPCR program followed the manufacturer’s instructions. Primer pairs of amino acid synthesis genes were designed and selected, and qPCR experiments were conducted as described above. For relative quantification, elongation factor 1α (EF1-α) (GenBank accession no. EE600682) was selected as a reference gene. The relative expression level of each gene was calculated according to the 2−ΔΔCt method (71 (link)).
7
Quantitative PCR of EOC Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from EOC specimens and cells were isolated using TRIzol solution (AndeBio, Xuhui, Shanghai, China). Subsequently, 1 μg total RNA was reverse transcribed into cDNA using cDNA Synthesis kits (Transgen, Shijingshan, Beijing, China). Then, qPCR was conducted using a SYBR–Green Master Mix kit (TIANGEN, Haidian, Beijing, China) and performed by CFX96 qPCR machine (Invitrogen, Carlsbad, CA, U.S.A.). The housekeeping gene, GAPDH, was used as internal control. The primers are listed in Table 1 . The 2−ΔΔCt method was used to calculate the relative fold changes.
8
Quantitative PCR Analysis of Bt Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The detailed procedure used for real-time quantitative PCR (qPCR) analysis to detect gene expression has been described elsewhere [66 (link)]. Gene-specific primers of MAPK cascade genes were selected in this study (S3 Table ), while qPCR primers of Bt resistance-related genes were obtained from our previous studies [30 (link)–33 (link)]. The qPCR reactions were performed with 2.5 × SYBR Green MasterMix Kit (TIANGEN) following the manufacturer’s instructions in the QuantStudio 3 Real-Time PCR System (Applied Biosystems). Four technical repeats and three biological replicates were conducted for each treatment. Relative expression levels of target genes were calculated using the 2-ΔΔCt method and normalized to the ribosomal protein L32 (RPL32) gene (GenBank accession no. AB180441).
9
Quantifying FOXCUT and FOXC1 mRNA in Colon Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantitatively determine the mRNA expression level of FOXCUT and FOXC1 in colon cancer cells, tissues and colonic epithelial cells, real-time PCR was performed, primers of qPCR were synthesized (Sangon Biotech, Shanghai, China) and primer information are showed in Table 2 . Total RNA was extracted from each sample using TRIzol Total RNA reagent (Invitrogen Life Technologies, USA) according to the manufacturer’s protocol. The concentration of RNA samples was measured using a NanoDrop 2000 (Thermo Scientific, USA) and the quality confirmed by agarose gel electrophoresis. Total RNA (1 μg) was reverse transcribed into cDNA with FastKing RT Kit including DNase treatment (Takara, Shiga, Japan). cDNA amplification was performed using the SYBR-Green master mix kit (Tiangen, China) following the manufacturer’s instructions. The reaction mixtures were incubated at 94°C for 5 min, followed by 40 cycles of 94°C for 5 sec,60°C for 34 sec and 72°C for 20 sec. Data were analyzed using the comparative threshold cycle (Ct) method (2−∆∆Ct).24 (link) The ACTB gene was used as an endogenous control. Triplicate wells were performed per sample.
Primer Sequences for Quantitative Real-Time PCR
| Gene Name | Forward | Reverse |
|---|---|---|
| FOXC1 | AAGATCACCCTGAACGGCATC | GGCACCTTGACGAAGCACTC |
| FOXCUT | TCCGATCATCTATCCCTTTACGA | CCCGGCTTCAAAAGACTCA |
| ACTB | CCACTGGCATCGTGATGGA | CGCTCGGTGAGGATCTTCAT |
10
Investigating TMED3's Immunomodulatory Role
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The correlation between TMED3 and immune in ltration degree and immune checkpoint of CD4 T lymphocytes, CD8 T lymphocytes, B cells, macrophages, and dendritic cells was carried out in the sangerbox (http://vip.sangerbox.com/home.html).
RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
The Total RNA Small Amount Extraction Kit (Axygen, Corning, USA) was used to extract total RNA from cell lines according to the manufacturer's instructions. Sangon Biotech developed primers for the ampli cation of TMED3 and the endogenous control actin (Shanghai, China). The SYBR Green master mix kit (Tiangen Biotech, Beijing, China) was used for qRT-PCR according to the manufacturer's instructions. The 2-ΔΔCt method was used to calculate fold changes in target gene expression.
Western blot and antibodies SDS-PAGE (Solar Bio, Beijing, China) was used to separate the protein, which was then transferred to a polyvinylidene uoride membrane (Millipore, Billerica, MA, USA) and mixed with TMED3(1: 2000), GAPDH (1: 10000; Proteintech, USA) was incubated at 4℃for 12 hours. The HRP-bound anti-mouse or rabbit IgG antibody (1:10000, a nity) was incubated for 2 hours at 25°C. ECL chemiluminescence reagent(UE,Suzhou,China) was used to detect the target protein band. The strip density was measured and compared to the internal control using a gel imaging technique.
RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
The Total RNA Small Amount Extraction Kit (Axygen, Corning, USA) was used to extract total RNA from cell lines according to the manufacturer's instructions. Sangon Biotech developed primers for the ampli cation of TMED3 and the endogenous control actin (Shanghai, China). The SYBR Green master mix kit (Tiangen Biotech, Beijing, China) was used for qRT-PCR according to the manufacturer's instructions. The 2-ΔΔCt method was used to calculate fold changes in target gene expression.
Western blot and antibodies SDS-PAGE (Solar Bio, Beijing, China) was used to separate the protein, which was then transferred to a polyvinylidene uoride membrane (Millipore, Billerica, MA, USA) and mixed with TMED3(1: 2000), GAPDH (1: 10000; Proteintech, USA) was incubated at 4℃for 12 hours. The HRP-bound anti-mouse or rabbit IgG antibody (1:10000, a nity) was incubated for 2 hours at 25°C. ECL chemiluminescence reagent(UE,Suzhou,China) was used to detect the target protein band. The strip density was measured and compared to the internal control using a gel imaging technique.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!