Prime star taq polymerase

The target sites for genome digestion were set approximately 200–600 bp upstream of the predicted transcriptional-start site of the target genes, with the sequence 5′-GA(17 N or 18 N)NGG-3′ or 5′-GG(17 N or 18 N)NGG-3′ with 50–70% GC content. Template DNA for sgRNA synthesize was PCR-amplified from pDR274^{38 (link)} with the forward primer, ATTTAGGTGACACTATAgaxxxxxxxxxxxxxxxxxxGTTTTAGAGCTA GAAATAGC (for SP6 polymerase) or TAATACGACT- CACTATAggxxxxxxxxxxxxxxxxxxGTTTTAGAGCTAGAAATAGC (for T7 polymerase), and the reverse primer, AAAAGCACCGACTCGGTGCC. The lowercase letters correspond to genome-targeting sequences in sgRNAs. The genome-targeting sequences in sgRNAs used in this study are shown in Table S2. After PCR amplification with Prime Star Taq polymerase (Takara, Otsu, Japan), PCR product was purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). Template DNA thus obtained was used for the in vitro transcription of sgRNAs using a MAXIscript T7 kit (Life Technologies, Carlsbad, USA). pCS2-hSpCas9 (gifted from M. Kinoshita and F. Zhang^{39 (link)}) was digested with NotI, and Cas9 mRNA was transcribed using an mMESSAGEmMACHINE SP6 kit (Life Technologies). sgRNAs and Cas9 mRNA were purified using a RNeasy Mini kit (Qiagen).

The substrates SHIK, phenylpyruvic acid, ATP, KCl, MgCl₂, PEP, FAD, NADH, β-Mercaptoethanol, L-Glutamic acid, pyridoxal phosphate were purchased from Sigma (St. Louis, MO, USA). Prime Star Taq polymerase was purchased from Takara and the restriction enzymes and T4 DNA ligase were purchased from NEB. Ni-NTA agarose resin was supplied by GE Healthcare for His-tagged protein purification. Na₂HPO₄ and other organic solvents used for HPLC were purchased from Merck (German). Other chemicals used in this article otherwise demonstrated were purchased from Solarbio (Beijing, China).
All kits and markers used for the construction of clones were from Omega Bio-tek, Inc (USA).

Fecal/colon tissue samples for microbiota analysis were collected from mice at different timepoints during the experiments and kept at −20°C until use. DNA was extracted using the Power Soil DNA Isolation Kit (MoBio) according to the manufacturer's instructions, following a bead beating step (BioSpec) for 2 minutes. Next, extracted DNA was used for PCR amplification of the V4 variable region of the bacterial 16S rRNA gene by primers, 515F- (barcoded) 5′-AATGATACGGCGACCACCGAGATCTACACGCTAGCCTTCGTCGCTATGGTAATTGTGTGYCAGCMGCCGCGGTAA-3′ and 806R 5′-CAAGCAGAAGACGGCATACGAGATAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3′ (20 (link)) PCR reactions were carried out with the Primestar Taq polymerase (Takara) for 30 cycles of denaturation (95°C), annealing (55°C) and extension (72°C), and final elongation at 72°C. Products were purified using AMPure magnetic beads (Beckman Coulter), and quantified using the Picogreen double-stranded DNA (dsDNA) quantitation kit (Invitrogen). Samples were then pooled at equal amounts, loaded on 2% agarose E-Gel (Thermo Fisher Scientific) and purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel). Purified products were sequenced using the Illumina MiSeq platform (Genomic Center, Azrieli Faculty of Medicine, BIU, Israel).